Busch Lab

ZMP

smarcd3a

Ensembl ID:
ENSDARG00000038786
ZFIN ID:
ZDB-GENE-070912-491
Human Orthologue:
SMARCD3
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 [S
Mouse Orthologue:
Smarcd3
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Ge

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8474 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18731
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056641 Nonsense 161 505 5 14
ENSDART00000137531 Nonsense 131 475 4 13
ENSDART00000140026 Nonsense 109 453 4 13
ENSDART00000145603 Nonsense 133 180 4 5
Genomic Location (Zv9):
Chromosome 2 (position 32249332)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32548239
GRCz11 2 32531457
KASP Assay ID:
2259-2230.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGGACCTCCTGGCCTTTGAGCGGAAACTTGACCAAACCATTATGAGG[A/T]AGCGGGTGGATATCCAGGAGGCCCTCAAAAGACCAATGAAGGTATGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8474
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056641 Nonsense 332 505 9 14
ENSDART00000137531 Nonsense 302 475 8 13
ENSDART00000140026 Nonsense 280 453 8 13
ENSDART00000145603 None None 180 None 5
Genomic Location (Zv9):
Chromosome 2 (position 32237505)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32536412
GRCz11 2 32519630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACAAGCTGCAGGAYTCTCATGAGAAAGAGTACATCAACTGTGAKAAATA[T/A]TTCCAGCAGGTGCTGCCYTTCTTCTGCCATATGAAGGACTCTCTTCATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25842
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056641 Essential Splice Site 368 505 10 14
ENSDART00000137531 Essential Splice Site 338 475 9 13
ENSDART00000140026 Essential Splice Site 316 453 9 13
ENSDART00000145603 None None 180 None 5
Genomic Location (Zv9):
Chromosome 2 (position 32237314)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32536221
GRCz11 2 32519439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAACCTGCTGCTGCCGCCTGATCCTATCGTGATCAATCACATTATCAG[G/A]TGACTGCTTATAAATGTAGAATTGTTTTACTCTTTATCATATACACTACC
Associated Phenotype:
Not determined