Busch Lab

ZMP

abcf2

Ensembl ID:
ENSDARG00000038785
ZFIN ID:
ZDB-GENE-030131-8714
Description:
ATP-binding cassette, sub-family F (GCN20), member 2 [Source:RefSeq peptide;Acc:NP_958472]
Human Orthologue:
ABCF2
Human Description:
ATP-binding cassette, sub-family F (GCN20), member 2 [Source:HGNC Symbol;Acc:71]
Mouse Orthologue:
Abcf2
Mouse Description:
ATP-binding cassette, sub-family F (GCN20), member 2 Gene [Source:MGI Symbol;Acc:MGI:1351657]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39862 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25841
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056640 Nonsense 175 613 4 15
Genomic Location (Zv9):
Chromosome 2 (position 32227052)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32525959
GRCz11 2 32509177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGATGGAGGTAGATGAGGAGAGGATAAAGCTGGAGAAGGAGGCAGAA[C/T]GATTGGCTCATGAGGACTGTGAGTTTAATTGACATGAATTTGAACATTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5148
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056640 Nonsense 247 613 6 15
Genomic Location (Zv9):
Chromosome 2 (position 32226273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32525180
GRCz11 2 32508398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTRRTTTTTCTGTAATCTTCAGGGCACTGTTCCTCAAACCCTTCATGT[T/A]GCTTTTGGATGAACCAACAAACCACCTGGACTTGGACGCCTGTGTGTGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5147
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056640 Essential Splice Site 406 613 10 15
Genomic Location (Zv9):
Chromosome 2 (position 32225073)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32523980
GRCz11 2 32507198
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTGTGATTATGGTTCAGAATGTCAGCTTCAGGTATTCGGAAAATACGG[T/C]ACGCAGTCTCATTGAGTCTCTTGTACCATGTTTTACTCGTCTCTGTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39862
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056640 Nonsense 575 613 14 15
Genomic Location (Zv9):
Chromosome 2 (position 32224074)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32522981
GRCz11 2 32506199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTGAGGGTGGAATGATGCTGGTCAGCCACGACTTTAGGCTAATTCAG[C/T]AGGTAATGTAATTCTCCTGTTTGTCACATTTAGATGATCTGTGTAAGAAG
Associated Phenotype:
Not determined