Busch Lab

ZMP

hkdc1

Ensembl ID:
ENSDARG00000038703
ZFIN ID:
ZDB-GENE-030131-9801
Description:
putative hexokinase HKDC1 [Source:RefSeq peptide;Acc:NP_001108597]
Human Orthologue:
HKDC1
Human Description:
hexokinase domain containing 1 [Source:HGNC Symbol;Acc:23302]
Mouse Orthologue:
Hkdc1
Mouse Description:
hexokinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384910]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42190 Nonsense Mutation detected in F1 DNA Not yet available
sa42189 Nonsense Mutation detected in F1 DNA Not yet available
sa42188 Nonsense Mutation detected in F1 DNA Not yet available
sa22286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42190
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 401 919 9 18
Genomic Location (Zv9):
Chromosome 13 (position 23163887)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22893225
GRCz11 13 23023675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGGTGGCTGCAGCTTTGGCTGCCATCCTAACACGGATCAGAGAAAAC[A/T]AAAAGCTGAAGACCCTTCGGACTACTGTAGGAGTGGATGGGACGGTCTAC
Long Flanking Sequence:
ATGAAAAGAAGATGGACAAATGAGAACCTTTCTGTCATACACTATAGTAAAACAGCTTGTCAAAAGCTGTGAACAGATTACATACAGGAATAGAGAAAAGAGCCCTCTTTAATTATCAGCTGTTAGTCAGCGCCCACTCTTTTTTCCTGGTGATTGCGCCTTTGCCGTGTGCTGTGTAAGTGCAGACGATCGGATACGAGTCCCTTTTAAAAGATGATGTAAGCAGGTCATCAAAAAAATCGGATACAGTCCCAAAATCGAAATTGACCATCAAGATCTGCAGTGTAAATGCAGCCCTATATGTGCATATTCTAATTGAGGATTTTTCCAGGTATAAAAGCGGTTTGGAAAACACCAAGGAGATCCTGGAGGACCTAGGACTAAATCCCAGTGACGATGACTGTATTGCAGTCCAGCATGTCTGCACCATCGTGTCCTTCAGGTCAGCTAATCTGGTGGCTGCAGCTTTGGCTGCCATCCTAACACGGATCAGAGAAAAC[A/T]AAAAGCTGAAGACCCTTCGGACTACTGTAGGAGTGGATGGGACGGTCTACAGAACACATCCACAGTACGTCAGTTCTCCTCAAATGTAAAATCCAAGGAGATTAATTTAAAATCAGAAGCGGCTAAATACTTTTATCTGATATTTAAAGGTACCCCAAAAGGCTCCACAAGGTGGTCCGCCATCTGGTGCCAGACTGCCATGTGCGTTTTGTGCTGTCTGAAAGTGGCAGTGCCAAAGGTGCCGCTATGGTGACCGCCGTGGCTCAGCGATTAGCCTCCCAGCGGAAAGAGATTGATGATACCCTTGCAGCTTTTGCTTTGACTTCCACACAGCTCCAGGAAGTGAAGCAGAAGATGCATGTTGAGTTGGAACGAGGCCTGAAAAAAGAAACCCATCCCACTGCTTCAGTAAAAATGCTGCCCACATATGTTTACAGGACACCAGATGGGACAGGTAATAGAAAATACCTACTTATTTATTTATTTGTTTGTTTATTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 581 919 12 18
Genomic Location (Zv9):
Chromosome 13 (position 23162961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22892299
GRCz11 13 23022749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTATTTATTTCCGTTTAATTTCAGCTGTTTGACCACATCGTTCAGTG[T/A]ATCTCAGATTTCTTGGACTATATGGGAATGAAGAACACTCGTCTGCCACT
Long Flanking Sequence:
ATATGTTTACAGGACACCAGATGGGACAGGTAATAGAAAATACCTACTTATTTATTTATTTGTTTGTTTATTTGCTTGTTTGTTTGAAGTCTAAGCATGATGATAACTGAGTAATTAGGATGTAAATTTTACTTTCACAGAAAGGGGAAAGTACCTTGCTTTGGATCTTGGTGGAACCAATTTCCGCGTGTTGGTGGTTAAGATTCGGACTGGCATGCGAAATTCAGTCCGGATGTACAACAAAATTTATGCCATCCCACTGGAGATTATGCAGGGCACAGGAGAGGAGGTAAAACACTATAAACAAATATGTTTTCATTATTTTTGTACAGTTAACGATGTATGTATATTATAATAATGTATATTATTACCATAATATACCCTATTTCATTTTAACACAATTTATATAGTCCAAAAAACTCAGCACAATAACAAGAATTTATACTGACCTATTTATTTATTTCCGTTTAATTTCAGCTGTTTGACCACATCGTTCAGTG[T/A]ATCTCAGATTTCTTGGACTATATGGGAATGAAGAACACTCGTCTGCCACTTGGCTTCACCTTCTCTTTCCCGTGCAATCAGACAGGTATTGATAAGGTAAAAAAGCATCTACCTCCAGTTATCAGTTTCTTTAATTGTCTATAAAAATAAATGAACGTATACTCAACCTGTTAAAACACACAGATAAACCCTGTGCTCAAATGATTGTCAAAGTCATTTTTCTTGCCCATTTGTTCAGGGAGATCTGGTCTGCTGGACAAAGGGCTTCAAAGCGACAGACTGTGAAGGGTATGATGTTGTGGACATGCTGAGAGAGGCCATCAAAAGACGAAATGTGAGCAGAAAGCAAACATAGTAAAGTAGTTTTACAGATCACACTCCTACACTTAAAGCGTAGCAGCACTATCATCAATACTAATGAATTGGGTTACATTTTCATGCATTCAGAGATTTGATTTAAAACAATAATAACGATTTATCTTATTTCTAACTGGAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42188
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 644 919 13 18
Genomic Location (Zv9):
Chromosome 13 (position 23162632)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22891970
GRCz11 13 23022420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGAAGGGTATGATGTTGTGGACATGCTGAGAGAGGCCATCAAAAGA[C/T]GAAATGTGAGCAGAAAGCAAACATAGTAAAGTAGTTTTACAGATCACACT
Long Flanking Sequence:
CAGTTAACGATGTATGTATATTATAATAATGTATATTATTACCATAATATACCCTATTTCATTTTAACACAATTTATATAGTCCAAAAAACTCAGCACAATAACAAGAATTTATACTGACCTATTTATTTATTTCCGTTTAATTTCAGCTGTTTGACCACATCGTTCAGTGTATCTCAGATTTCTTGGACTATATGGGAATGAAGAACACTCGTCTGCCACTTGGCTTCACCTTCTCTTTCCCGTGCAATCAGACAGGTATTGATAAGGTAAAAAAGCATCTACCTCCAGTTATCAGTTTCTTTAATTGTCTATAAAAATAAATGAACGTATACTCAACCTGTTAAAACACACAGATAAACCCTGTGCTCAAATGATTGTCAAAGTCATTTTTCTTGCCCATTTGTTCAGGGAGATCTGGTCTGCTGGACAAAGGGCTTCAAAGCGACAGACTGTGAAGGGTATGATGTTGTGGACATGCTGAGAGAGGCCATCAAAAGA[C/T]GAAATGTGAGCAGAAAGCAAACATAGTAAAGTAGTTTTACAGATCACACTCCTACACTTAAAGCGTAGCAGCACTATCATCAATACTAATGAATTGGGTTACATTTTCATGCATTCAGAGATTTGATTTAAAACAATAATAACGATTTATCTTATTTCTAACTGGAGCACTAAAACATTTTGTTTTTTTTAACAAATAACTAACGTTACTTTTCAGTTGTGTTGCTTGATTTAACATGCCATCCTGTTTGGTAATGGTAGCATGAATTGAAACTTTGCTAATAAGTTTAGAAGCAAAGATTAACATCGCTAACCTGTTTTAAAGCATTGTTTCAATGCACTACTAGCATGTTTATCGCTTACTTTAGCACATTGTTAGCATGTTCAACTGGTTTTTTTAATAATTGTTAGCATATGCTATGCTAGTCGCTAATCTTTGCTCATGATAGATAGCTACAGTAGAACTGTTTAAATCCTGTAAGATTTACTGTTTGAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4500
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Essential Splice Site 645 919 13 18
Genomic Location (Zv9):
Chromosome 13 (position 23162626)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22891964
GRCz11 13 23022414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGSTATGATGTTGTGGACATGCTGAGAGAGGCCATCAAAAGACGAAAT[G/T]TGAGCAGAAAGCAAACATAGTAAAGTAGTTTTACRGATCACACTCCTACA
Long Flanking Sequence:
ACGATGTATGTATATTATAATAATGTATATTATTACCATAATATACCCTATTTCATTTTAACACAATTTATATAGTCCAAAAAACTCAGCACAATAACAAGAATTTATACTGACCTATTTATTTATTTCCGTTTAATTTCAGCTGTTTGACCACATCGTTCAGTGTATCTCAGATTTCTTGGACTATATGGGAATGAAGAACACTCGTCTGCCACTTGGCTTCACCTTCTCTTTCCCGTGCAATCAGACAGGTATTGATAAGGTAAAAAAGCATCTACCTCCAGTTATCAGTTTCTTTAATTGTCTATAAAAATAAATGAACGTATACTCAACCTGTTAAAACACACAGATAAACCCTGTGCTCAAATGATTGTCAAAGTCATTTTTCTTGCCCATTTGTTCAGGGAGATCTGGTCTGCTGGACAAAGGGCTTCAAAGCGACAGACTGTGAAGGGTATGATGTTGTGGACATGCTGAGAGAGGCCATCAAAAGACGAAAT[G/T]TGAGCAGAAAGCAAACATAGTAAAGTAGTTTTACAGATCACACTCCTACACTTAAAGCGTAGCAGCACTATCATCAATACTAATGAATTGGGTTACATTTTCATGCATTCAGAGATTTGATTTAAAACAATAATAACGATTTATCTTATTTCTAACTGGAGCACTAAAACATTTTGTTTTTTTTAACAAATAACTAACGTTACTTTTCAGTTGTGTTGCTTGATTTAACATGCCATCCTGTTTGGTAATGGTAGCATGAATTGAAACTTTGCTAATAAGTTTAGAAGCAAAGATTAACATCGCTAACCTGTTTTAAAGCATTGTTTCAATGCACTACTAGCATGTTTATCGCTTACTTTAGCACATTGTTAGCATGTTCAACTGGTTTTTTTAATAATTGTTAGCATATGCTATGCTAGTCGCTAATCTTTGCTCATGATAGATAGCTACAGTAGAACTGTTTAAATCCTGTAAGATTTACTGTTTGAAAGTTTGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22286
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 739 919 15 18
Genomic Location (Zv9):
Chromosome 13 (position 23161155)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22890493
GRCz11 13 23020943
KASP Assay ID:
2260-6353.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACCAGATATGACAGAGAGGTCGACAGCGGCTCACTCAATGCTGGGAAA[C/T]AAAGGTAAATATTACAATGTTTCGATAGTTTTATTATAACATTTTTAATA
Long Flanking Sequence:
TTCATTTAAAGCACTTTGAATTACCCTTGTGTATGAAATGTGCTATATACAGTAAACAAACTTGCCTTGCATTGATAACATGTTAACATAATAACTTGTTTTTACAGGAGTTTGATCTCGATATCGTAGCTATAGTTAATGACACAGTTGGCACAATGATGACCTGTGCATATGAGGACCCTAAATGTCAGATTGGTCTTATTGCTGGTATGTATTAATGCATTTCTGTGGTATTTTAGGCTACCTTACTCCTCATTACAAACCAAAATATGTACAGAAAGAAATATAATTTTCAAACATGCATGATTCTTAACTCTACAGGAACAGGAAGCAATGTGTGTTACATGGAGGAGATGAAGAACATTGAGATTGTTGAGGGTGATGAAGGACAGATGTGTGTAAACACTGAGTGGGGAGGTTTTGGAGAAAATGATAATATTGAGGACATCCGGACCAGATATGACAGAGAGGTCGACAGCGGCTCACTCAATGCTGGGAAA[C/T]AAAGGTAAATATTACAATGTTTCGATAGTTTTATTATAACATTTTTAATATTATGTATTTATACTGTATAGTTTATATAGTTTTATTTTTTTATGGTTATCTACACAATTGTGCAAGGTAAATGCAATGCAAGGTTTCTGCGTTTGTCCACATGGAGGCAGCATACTATAATGATTCCCTTAAAACATAGGAATGGTGTTAGCAACCTGTTGTAATACACAAAAAAAAATGTCTTTAAATAGCAAAAAATATATATAATTTTTATTTGACGCTTTTTTTTTTGTTTTTTGCTACTAAATACAAATGTAATTTTACTATTGTTGTTATTAAATATTTAATCAATTAAAATATACTAAACATTAAAATATACAATATATACTATAATTCACTCATTTATTTTCTTTTCGGCTTAGTCCTTTTATTTATCTGGGGTCGCCAGAGCAGAATGAACCGACAACTTATCCAGCATATGAAATTAAGCAAGTTTACACAGTGGATGT
Associated Phenotype:
Not determined