Busch Lab

ZMP

wu:fj11g02

Ensembl ID:
ENSDARG00000038681
ZFIN ID:
ZDB-GENE-030131-7370
Human Orthologues:
ANGPTL1, ANGPTL2, ANGPTL6, FGA
Human Descriptions:
angiopoietin-like 1 [Source:HGNC Symbol;Acc:489]
angiopoietin-like 2 [Source:HGNC Symbol;Acc:490]
angiopoietin-like 6 [Source:HGNC Symbol;Acc:23140]
fibrinogen alpha chain [Source:HGNC Symbol;Acc:3661]
Mouse Orthologues:
Angptl1, Angptl2, Angptl6, Fga
Mouse Descriptions:
angiopoietin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919963]
angiopoietin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1347002]
angiopoietin-like 6 Gene [Source:MGI Symbol;Acc:MGI:1917976]
fibrinogen alpha chain Gene [Source:MGI Symbol;Acc:MGI:1316726]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25720 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25720
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100203 Nonsense 103 245 3 5
Genomic Location (Zv9):
Chromosome 1 (position 59850229)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58318019
GRCz11 1 59095167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGTGGAGAGACTACAAGAGAGGATTCGGGAATGTGGAGGGAGAATACT[G/A]GCTGGGTGAGTTGGTTTGGCTGTCTTTGTGCAATGTTTGGTTCAAAATGT
Associated Phenotype:
Not determined