Busch Lab

ZMP

gga1

Ensembl ID:
ENSDARG00000038537
ZFIN ID:
ZDB-GENE-040822-13
Description:
ADP-ribosylation factor-binding protein GGA1 [Source:RefSeq peptide;Acc:NP_001004000]
Human Orthologue:
GGA1
Human Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 1 [Source:HGNC Symbol;Acc:17842]
Mouse Orthologue:
Gga1
Mouse Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11719 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11719
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038818 Essential Splice Site 380 635 12 17
Genomic Location (Zv9):
Chromosome 6 (position 23815507)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20070953
GRCz11 6 22131175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGACTTCTTCCCAATCTGGAGATGCTATGGGGTGGAATACTTTTCAGG[T/C]GGGCAGATAAATAAKTTTCATCTATTTGTTCTGATTGTGTGACAATTAGC
Associated Phenotype:
Not determined