Busch Lab

ZMP

zgc:63645

Ensembl ID:
ENSDARG00000038472
ZFIN IDs:
ZDB-GENE-040426-1208, ZDB-GENE-040426-1208
Description:
Zgc:63645 protein [Source:UniProtKB/TrEMBL;Acc:Q6PGX6]
Human Orthologue:
MTMR4
Human Description:
myotubularin related protein 4 [Source:HGNC Symbol;Acc:7452]
Mouse Orthologue:
Mtmr4
Mouse Description:
myotubularin related protein 4 Gene [Source:MGI Symbol;Acc:MGI:2180699]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38154 Nonsense Mutation detected in F1 DNA Not yet available
sa44374 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38154
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056149 Nonsense 169 361 7 12
ENSDART00000129940 Nonsense 264 1107 7 18
Genomic Location (Zv9):
Chromosome Zv9_scaffold3484 (position 78035)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 2062060
GRCz11 5 2330272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCAGCCGGAGATCAGCTGGTGGGGCTGGAGAAACACAGAGGATGAATA[T/A]CTGGTCACATCCATAGCCAAAGCCTGTCAACTGGACGGAGGATCTCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44374
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056149 None None 361 None 12
ENSDART00000129940 Nonsense 532 1107 12 18
Genomic Location (Zv9):
Chromosome Zv9_scaffold3484 (position 89898)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 2050197
GRCz11 5 2318409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCACGTTTCTGTGTAATAACGGTAAAGAGCGCGAGACCCGTAACGTCTA[C/A]AAGAGGACCTGCTCTATCTGGTCTCTTCTGCGCACTGGAAACAAGAACTT
Associated Phenotype:
Not determined