Busch Lab

ZMP

si:dkey-8k3.2

Ensembl ID:
ENSDARG00000038424
ZFIN ID:
ZDB-GENE-100922-98
Human Orthologues:
C4A, C4B
Human Descriptions:
complement component 4A (Rodgers blood group) [Source:HGNC Symbol;Acc:1323]
complement component 4B (Chido blood group) [Source:HGNC Symbol;Acc:1324]
Mouse Orthologue:
C4b
Mouse Description:
complement component 4B (Childo blood group) Gene [Source:MGI Symbol;Acc:MGI:88228]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22797 Essential Splice Site Available for shipment Available now
sa12941 Nonsense Available for shipment Available now
sa44845 Nonsense Mutation detected in F1 DNA Not yet available
sa22796 Nonsense Available for shipment Available now
sa16232 Nonsense Available for shipment Available now
sa14061 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22797
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Essential Splice Site 88 1719 2 41
ENSDART00000143550 Essential Splice Site 96 1725 2 41
Genomic Location (Zv9):
Chromosome 16 (position 18749808)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCAAAACAATACACCAAAAAGGAAAGTTTGAGACAGTGAATCTTGAGG[T/C]AATGCATATCTTAGTAAAAATGCATTTACAAGTAAATTAAGGCCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12941
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Nonsense 106 1719 3 41
ENSDART00000143550 Nonsense 114 1725 3 41
Genomic Location (Zv9):
Chromosome 16 (position 18749576)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16788987
GRCz11 16 16696964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGCAAATACAGTTTCAAACCTGAAGTCAATCAAYGGAGAGCCTCCTTA[T/A]CTAAATCTGGCATGTGAGGTTGAWGGTCAGAGACAGCAGACRCGTGWTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Nonsense 519 1719 13 41
ENSDART00000143550 Nonsense 527 1725 13 41
Genomic Location (Zv9):
Chromosome 16 (position 18744979)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16784492
GRCz11 16 16692469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAGTAAAAAAATCCATCCAAATAAAACCAAACATGACCCCATCCTTC[A/T]GATTGATTGCTTTTTACTATATCAAAGAGGGTGACATCATCGCTGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22796
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Nonsense 856 1719 21 41
ENSDART00000143550 Nonsense 864 1725 21 41
Genomic Location (Zv9):
Chromosome 16 (position 18733786)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16770669
GRCz11 16 16678646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACCAATACAATCTTCTAAATAATTTTTCAGCTTGTTGTGCGCATGCGA[C/T]AAGTGGATGGTCTTTGTTCACCCGGGTCAGCAACGTCATCATCTTCCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Nonsense 1020 1719 24 41
ENSDART00000143550 Nonsense 1028 1725 24 41
Genomic Location (Zv9):
Chromosome 16 (position 18732901)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16769783
GRCz11 16 16677760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTCTCCCACTGCCTTGTCAATCCGTTACCTGGATAAAAGTCAGCGCTG[G/A]CTKGAACTAGAAGCAGGATCCMGAGACAAAGCACTGGATTTCATTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Nonsense 1480 1719 35 41
ENSDART00000143550 Splice Site None 1725 None 41
Genomic Location (Zv9):
Chromosome 16 (position 18722772)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16759576
GRCz11 16 16667553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTTAACTTCCTTTGTTTTTTTNCTCCTTTTCCCTRATTTCCTATGCAA[C/T]AGCTGAAAGGCCTGGTGGACAAATATATTTCTCACTATGAGGTCACACGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28621
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079630 Nonsense 1537 1719 36 41
ENSDART00000143550 Nonsense 1543 1725 36 41
Genomic Location (Zv9):
Chromosome 16 (position 18722512)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16759315
GRCz11 16 16667292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCCTATTGGTTTAGTTCAACCTGCTCCAGCTTTGTTTTATGATTACTA[T/A]GAACCAGGCAAGCTGTTCCTTCATTACAAGTCAGATGTACCATAACAATA
Associated Phenotype:
Not determined