Busch Lab

ZMP

taf2

Ensembl ID:
ENSDARG00000038423
ZFIN IDs:
ZDB-GENE-030131-3207, ZDB-GENE-030131-3848
Description:
Transcription initiation factor TFIID subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q32PW3]
Human Orthologue:
TAF2
Human Description:
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf2
Mouse Description:
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa28589 Nonsense Mutation detected in F1 DNA Not yet available
sa22760 Nonsense Available for shipment Available now
sa25004 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28589
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 13 1191 2 27
Genomic Location (Zv9):
Chromosome 16 (position 11049058)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9690117
GRCz11 16 9581019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCGAAGAAAGAATGAACCGCAAGAAAGACAAGGGCTTTGAGAGCCCA[C/T]GACCATATAAACTATAAGTATCAAATACGTTTTGTCTCTCACTGAATTGA
Long Flanking Sequence:
CATTAAAACATACAGGAGGAGGAGCGACAGCTCATGCTCCCCCTCGCTGGAGCTCAGCTCTCCTCAAATGGCTCTGCAGCGAGCACCTTAAGTATGGAATCGTAGATTCAGATCCGTACTCCATTCCAGTCGGTGGCGGTAATGCACCAGTAAGTAAGGTTGGTAAGAAGAAAAAAAGAAGAACAACAACATCCAGGCAGGAACTCGGCGCGGGAGGGCAGAGCAAAGCAACAACATGGCTAAAGATTTGGGGCGAAAATTGTTTTGTTGGTAATTTCATAATAGAAAAAACTGAAGAGTGTCGGTACATGTTATAACAACACTTAAACAAATAAGGACATGACGAAATGGACTTAAGGTATTTTTGAGCCAGAAGAAAATTGTTTTTAGTTTTTTTAAAACATATTCAACCAAAACACTGGTTTTGTTTTTCCCAGGGTTTAAGTGAATAAACCGAAGAAAGAATGAACCGCAAGAAAGACAAGGGCTTTGAGAGCCCA[C/T]GACCATATAAACTATAAGTATCAAATACGTTTTGTCTCTCACTGAATTGACTAACGTAACGTTTACGTTAATCACAGTTGTGTTTACATTGCACATGAGAATTAATTCTGATGATCGCTATTTACGTTACTCTTTGTTTATCTCTATACGACCCATCAGGTTGTCTGCATCAACAATGTAAATTTTCAGAGGAAGTCTGTCATTGTGAGTATGCAATTTCCATTTCTTCGTGAACGTTATGTGAATGAAGCAGAAAATATTAAGGGACTTTGTATGCAGTCTATTAAAAATTTAAACAGCGAGGCATGATGTATGTGGAAAATTTGCAATACGTCTTAACAGCATTTTTATTGAGAACAGATTTAAATTGACGTTCATGGTTTCATGATCCAGTAATCACATGCATTTATAGCCATTAATTAAGCTGATTTTGTATAGTTGTAAAATGTCAGATTGTAATGTTATGCTGTCTTGTTATAGAGGTAAAGTTGATTTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 533 1191 14 27
Genomic Location (Zv9):
Chromosome 16 (position 11060094)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9701153
GRCz11 16 9592055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGTCAAATTTTTTGGAAGTTTTGCTTTTAACAGGAAAAGAAATGTTT[T/A]GGAACTAGAGATTCGCCAGGACTACACATCATCAGGCACACAGAAATATG
Long Flanking Sequence:
TAGATAATGAATAATGACACCAACATTTTTATTTCTGTTGAAGGTGCATAGCCATGTAATGACTGGAATGATGTGCAATTAGCAGCAACTGCTGGGACTTAGGGGGATTGCTTATGAAGTTTATAACTAATAAACTATAGAACCTAGGACTGGGTGAAATATTATGTTTTAACTATATTTTTATTTCTTTTTTCAAAACAATGCAGTATTAACCAACACCAATAAAATGTATATAGTTTGCCTTGTAGTGGTGCTTTGCAGAATGATAGTGCATAAGGTGTATTCCCACCAATGACCTTATTGTGATAAACTTCATTAATTCATTTTCCTTTGGCATAGTCCCTTATTTATCAGGGCTTGCCACAGTGGAATGAACTTCCTGTAATAAGCTTATTGTAGTTAACCAATATATTATTACCTTTGACTCATCAGCCTCAGAGACCAGAGTGGAGTGGTCAAATTTTTTGGAAGTTTTGCTTTTAACAGGAAAAGAAATGTTT[T/A]GGAACTAGAGATTCGCCAGGACTACACATCATCAGGCACACAGAAATATGTGGTAAATGCATACAGAGGAAAAATAAATGGCTTTATGTAATTAATGAAGACACTACAATAGTCTTATGTGGTCCAACATCGTTTTGTCCATGTTTTAGGGCCCTATAAAAGTGACAGTACAGGAATTGGATGGGTCATTTAACCACACTTTGCAGATTGAGGAGAACAGTCTCAAACATGACATTCCCTGCCACTCCAAAAGCAGAAGGTGGTGTTTTGTATCTAGAATAAATGTAATGAAAAAAAATCTAATTTAATTGCATTTAGTTTTTCCATACAGCACTTACCAATATAGAAATTATTATAACTTGTTTTGATTGCTTTTGGCAGGAACAAGAAAAAGAAAATCCCTTTGATGAATGGAGAAGAAGTTGATATGGACTTGTCAGCCATGGAGTAAGCCTTATGCTCTTATAGCACATAGCTCAGTTTATAGCTTCATTACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25004
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 595 1191 16 27
Genomic Location (Zv9):
Chromosome 16 (position 11060499)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9701558
GRCz11 16 9592460
KASP Assay ID:
554-7431.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACTTGTTTTGATTGCTTTTGGCAGGAACAAGAAAAAGAAAATCCCTT[T/A]GATGAATGGAGAAGAAGTTGATATGGACTTGTCAGCCATGGAGTAAGCCT
Long Flanking Sequence:
AATATATTATTACCTTTGACTCATCAGCCTCAGAGACCAGAGTGGAGTGGTCAAATTTTTTGGAAGTTTTGCTTTTAACAGGAAAAGAAATGTTTTGGAACTAGAGATTCGCCAGGACTACACATCATCAGGCACACAGAAATATGTGGTAAATGCATACAGAGGAAAAATAAATGGCTTTATGTAATTAATGAAGACACTACAATAGTCTTATGTGGTCCAACATCGTTTTGTCCATGTTTTAGGGCCCTATAAAAGTGACAGTACAGGAATTGGATGGGTCATTTAACCACACTTTGCAGATTGAGGAGAACAGTCTCAAACATGACATTCCCTGCCACTCCAAAAGCAGAAGGTGGTGTTTTGTATCTAGAATAAATGTAATGAAAAAAAATCTAATTTAATTGCATTTAGTTTTTCCATACAGCACTTACCAATATAGAAATTATTATAACTTGTTTTGATTGCTTTTGGCAGGAACAAGAAAAAGAAAATCCCTT[T/A]GATGAATGGAGAAGAAGTTGATATGGACTTGTCAGCCATGGAGTAAGCCTTATGCTCTTATAGCACATAGCTCAGTTTATAGCTTCATTACATCAATGATCTTTTAAGGCAGGGGTCTCAAACTCGATTTACCTGGGGGCCGCAGGAGGCAAAGTCTGGGTGAGGCTGGGCCGCATAAGGGATTTCACAAAAAAAAAGTCCTCAAATGTCATTATTAACAGTTTTCATTTTTTCTTCTGAACATGAAGTGTCCTGAACATTAATAGAACATTGAGTGAAGATTATGAACAGTTCTTATGAGCATGGCATCTTTTGCCTACTCCTTGCTGCCAGAGACTTGACAGCGCTTCTTCTCACAAATCTGAACCACATTTGGCTTTAGAGCGGAAGCAGTTGAGACCCTCAGTATGGCTTGGGGGAACTCACTCAAAACTTCCATTCCGTCACCTAAAAAAAAAGGCGTATATATGTATAAATAAAACACCCCCACCCCACTCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28590
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Essential Splice Site 949 1191 23 27
Genomic Location (Zv9):
Chromosome 16 (position 11069213)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9710272
GRCz11 16 9601174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTAACGAGGCTTTAGTAGACCAACTGTGGAAGCTGATGAACTCGGG[T/C]AAAACACATTATTATTATTATTATTATGCTCTCTCTCAATTTGGTTTGTT
Long Flanking Sequence:
CCTCATGGCTCTTTACATATTTTTTATGTGGTGCCTAGACGCACATTGTGTGCATCAGATAAGTTTTAATTTGGCACTCAGATGCATTTTCCGTGGATCACATGAGATTTTTTTTTTAATATTTGCACACTTGCAACTAAATAGATTTTACAGTTTGCACTTATCTATTTTTAGTTATGAAATGTTGCACTGTTGAGCCCTCCTTAACACAAATGCTTTATAGCATGCACTTATTACAGTCTGTTACTAATATTTTATTGTCATATGAATTCATAAAAAAAAAAACTGTGGCATGTGTTGCGTATATAACAGTGATTCTCAATGTTTAACTGCTGTATGTTTTTATTTATTTAAATTTTAGACTTCAGTTATTTTCTGCCCTATTTTAGGCATGAGATTCTCAGCATGCTTGCCAAGAATCCACCGTTTACAAAAGCAGCAGATTCATCATTGTGTAACGAGGCTTTAGTAGACCAACTGTGGAAGCTGATGAACTCGGG[T/C]AAAACACATTATTATTATTATTATTATGCTCTCTCTCAATTTGGTTTGTTTTAAGACCCTCCGGAATTATTACATGTGTTCTTCCTCAAAACACTGTTATGTGCCCTATGATTCATTTTAGTTCTGTTTTCATGACCAGTTGGGGACTATTGATCTGAAACAGATGAAATTGTGAAAGTAACCGTTCAATTGCTGTTTAACTCCCTATGCCTTCAAATCTGCTTTTGATTATTGGATGCCTCTTTGAATTTGGCATAATTTTTTTAAGAAGCATTGTCTGTTTTGGGAAAATGTATTGTATTGAAACCCAATTATTGTAATTGGAGGTTTGCAGAAACTATTGGCAGTACAGCTGCAACACATTGTTGCTCCAACCCTAACCCTGATTCATCTAATCAATGTCTTTAAGATTATAAGAAACTTACAAGTAGGTGTAATGTAGTGCTAAACTGTACATTGGTGTGGCCCTCCAAAGAAGTGAGTTTGATATCACTGTTGTA
Associated Phenotype:
Not determined