Busch Lab

ZMP

entpd4

Ensembl ID:
ENSDARG00000038422
ZFIN ID:
ZDB-GENE-040718-116
Description:
ectonucleoside triphosphate diphosphohydrolase 4 [Source:RefSeq peptide;Acc:NP_001002419]
Human Orthologue:
ENTPD4
Human Description:
ectonucleoside triphosphate diphosphohydrolase 4 [Source:HGNC Symbol;Acc:14573]
Mouse Orthologue:
Entpd4
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 4 Gene [Source:MGI Symbol;Acc:MGI:1914714]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34503 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6105 Nonsense Mutation detected in F1 DNA Not yet available
sa31685 Essential Splice Site Available for shipment Available now
sa34502 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34503
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Essential Splice Site None 611 1 13
Genomic Location (Zv9):
Chromosome 8 (position 52644181)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50162383
GRCz11 8 50151029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGAGGATGGGTCTTAAATGAGGGCATCCGTCCCAGATGTAGCCGAACGG[T/C]GAGAGCATATGCCTGCGTTCACACACATATTCTAAATACTCAACCGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6105
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Nonsense 281 611 8 13
Genomic Location (Zv9):
Chromosome 8 (position 52631767)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50174797
GRCz11 8 50163443
KASP Assay ID:
554-3817.1 (used for ordering genotyping assays)
KASP Sequence:
CGTACRGCTGGTGTTTTGGACATGGGTGGCGTYTCCACTCAGATCGCATA[T/A]GAAGTGCCCAAAACTGTAAGCTTTGCTTCTCCACAACAGGTTATTATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31685
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Essential Splice Site 286 611 8 13
Genomic Location (Zv9):
Chromosome 8 (position 52631750)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50174814
GRCz11 8 50163460
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACATGGGTGGCGTTTCCACTCAGATCGCATATGAAGTGCCCAAAACTG[T/C]AAGCTTTGCTTCTCCACAACAGGTTATTATCTATGACAATTTCCCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34502
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Nonsense 350 611 10 13
Genomic Location (Zv9):
Chromosome 8 (position 52624560)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50182004
GRCz11 8 50170650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTATGTGCTCCTGTTGTGTCCGTAGGCTGTTGAATCAGCATCAGGGA[G/T]AGAGCGCAGACTCGCCCATCCTGGACCCGTGTTTGCCTGTGGATCTTCAG
Associated Phenotype:
Not determined