Busch Lab

ZMP

sag

Ensembl ID:
ENSDARG00000038378
ZFIN ID:
ZDB-GENE-050913-98
Description:
S-antigen; retina and pineal gland (arrestin) [Source:RefSeq peptide;Acc:NP_001028921]
Human Orthologue:
SAG
Human Description:
S-antigen; retina and pineal gland (arrestin) [Source:HGNC Symbol;Acc:10521]
Mouse Orthologue:
Sag
Mouse Description:
retinal S-antigen Gene [Source:MGI Symbol;Acc:MGI:98227]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36002 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22731 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36002
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055995 Essential Splice Site None 176 1 8
Genomic Location (Zv9):
Chromosome 15 (position 44848113)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45625581
GRCz11 15 45640963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACACACAGGATCATCTGCGTCTCAACACACAAGCACACACAGACAGG[T/C]GAGTGATACTGCACGACTACGGCTGATCTCAGCACATTTACAGTAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055995 Essential Splice Site 154 176 7 8
Genomic Location (Zv9):
Chromosome 15 (position 44856112)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45633580
GRCz11 15 45648962
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAATGTGCTGTGGAGTTTGAAGTGAAGGCCTTCTGTGCAGAAAATCAG[G/A]ATGAAAAAGCCCAAAAGAGGTAAGAAAAATCACAATCGCACAATTTTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28547
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055995 Nonsense 161 176 8 8
Genomic Location (Zv9):
Chromosome 15 (position 44870016)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45647384
GRCz11 15 45662766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATCTATAGCTGATTAACCATGTGGATGGATGACAACAGCTTTCTGTG[C/A]CTACCAGTAGGCACAGAAGGCCCCCACTGGCCCATATCTATCAGCTGATA
Associated Phenotype:
Not determined