Busch Lab

ZMP

si:dkey-24n17.5

Ensembl ID:
ENSDARG00000038302
ZFIN ID:
ZDB-GENE-091204-207
Human Orthologue:
KIAA1967
Human Description:
KIAA1967 [Source:HGNC Symbol;Acc:23360]
Mouse Orthologue:
2610301G19Rik
Mouse Description:
RIKEN cDNA 2610301G19 gene Gene [Source:MGI Symbol;Acc:MGI:2444228]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa735 Missense, Nonsense Available for shipment Available now
sa34811 Nonsense Available for shipment Available now
sa13417 Essential Splice Site Available for shipment Available now
sa21636 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa630
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075709 Nonsense 88 860 3 20
ENSDART00000133128 Nonsense 92 233 5 8
ENSDART00000136618 Nonsense 88 112 4 4
ENSDART00000140803 Nonsense 92 792 5 19
ENSDART00000141505 Nonsense 92 140 5 6
Genomic Location (Zv9):
Chromosome 10 (position 2905301)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2850938
GRCz11 10 2878109
KASP Assay ID:
554-0540.1 (used for ordering genotyping assays)
KASP Sequence:
TCCCCCTCCGCTGCTGCCCTCCATGTCATCCACTCTGAAGCCGGGGATTT[T/A]AGGGACCAAACCACAACCTCTGCTGAAATCCCCCAAAATACCACCGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa735
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075709 Nonsense 161 860 5 20
ENSDART00000133128 Missense 180 233 7 8
ENSDART00000136618 None None 112 None 4
ENSDART00000140803 Missense 180 792 7 19
ENSDART00000141505 None None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 2907749)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2853386
GRCz11 10 2880557
KASP Assay ID:
554-0642.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGGGAGGAGACCTCATGCACCAGAAACGRAAGAGATGGAGGGCCACAT[C/T]AGAAGAGGAAGCGCCCAAAAAGASCAGCTCTGCAGCCACACACAGCGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075709 Nonsense 239 860 6 20
ENSDART00000133128 None None 233 None 8
ENSDART00000136618 None None 112 None 4
ENSDART00000140803 Nonsense 258 792 8 19
ENSDART00000141505 None None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 2909438)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2855075
GRCz11 10 2882246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGCCACTACCTCTAAGAGGACCCTGTCTCTTCCACATAGGACCAAAC[C/T]AGCCGGAGACTGAAGCGGACGTTTGCGAGTCCACCGATGATGCTTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13417
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075709 Essential Splice Site 295 860 8 20
ENSDART00000133128 None None 233 None 8
ENSDART00000136618 None None 112 None 4
ENSDART00000140803 Essential Splice Site 314 792 10 19
ENSDART00000141505 None None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 2909949)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2855586
GRCz11 10 2882757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAAGCRTGATGAGTTTAATGTGTGATTGTGTGSTCTTCTTCCCTAATA[G/A]TTTCTGATAGTGGACAGTGGAGGTGAMCAGCGTCTTCCAGRAGGCCAYTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21636
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075709 Nonsense 505 860 14 20
ENSDART00000133128 None None 233 None 8
ENSDART00000136618 None None 112 None 4
ENSDART00000140803 Nonsense 471 792 13 19
ENSDART00000141505 None None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 2915286)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2860923
GRCz11 10 2888094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGAGATGTTCAGCGAGATGCTCCAGAGGGATTTTGGGCTTCAGCTGTA[T/A]CGGTGTCTCTGCAGTCTGCCTCAAAACATCAGCGACCCACAGACTGAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27537
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075709 Essential Splice Site 793 860 18 20
ENSDART00000133128 None None 233 None 8
ENSDART00000136618 None None 112 None 4
ENSDART00000140803 None None 792 None 19
ENSDART00000141505 None None 140 None 6
Genomic Location (Zv9):
Chromosome 10 (position 2921860)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2867497
GRCz11 10 2894668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGTACATTACAGGCCAAAAATAACTACTTGCTCAAAACACACTTGC[G/C]TTGAGAGAGAGAGAAGAGTGTTTCTACAGGTGGTTTGTCAATCCCACTCA
Associated Phenotype:
Not determined