Busch Lab

ZMP

pdlim5

Ensembl ID:
ENSDARG00000038267
ZFIN ID:
ZDB-GENE-040718-401
Description:
PDZ and LIM domain 5 [Source:RefSeq peptide;Acc:NP_001002654]
Human Orthologue:
PDLIM5
Human Description:
PDZ and LIM domain 5 [Source:HGNC Symbol;Acc:17468]
Mouse Orthologue:
Pdlim5
Mouse Description:
PDZ and LIM domain 5 Gene [Source:MGI Symbol;Acc:MGI:1927489]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13197 Essential Splice Site Available for shipment Available now
sa26402 Nonsense Mutation detected in F1 DNA Not yet available
sa18440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13197
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099945 Essential Splice Site None 551 1 14
ENSDART00000145371 Essential Splice Site None 220 1 5
Genomic Location (Zv9):
Chromosome 5 (position 8559226)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7329878
GRCz11 5 7834516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCANNNCNNNGGAGTTTTGTTTTSCRTTTTGGGAAAAGTGMTGCTTTCTAAAGG[T/A]AAATCCATGATTGCATTGTTTATTGTRCTGTTGTTGTGGTTGCCAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26402
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099945 Nonsense 140 551 5 14
ENSDART00000145371 Nonsense 140 220 5 5
Genomic Location (Zv9):
Chromosome 5 (position 8622664)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7266477
GRCz11 5 7771115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCACGTCATCCTCCAATAGGAGCGCTCGTCCATTTGGAGGGGCGGGGT[C/A]ACCACCCATAGCCTTCATTCCCTCCACTGCATCTGCTTTTGCACCCGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099945 Nonsense 212 551 5 14
ENSDART00000145371 Nonsense 212 220 5 5
Genomic Location (Zv9):
Chromosome 5 (position 8622879)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7266262
GRCz11 5 7770900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ARAATGCCTGTGAGGTTGCCATGGGCCAGAGGCGGGGCCTGCTGGAAAGC[C/T]AGGGTGAGAGCTGTCAGCTRAATGGGTAAGAGTTTGATTGAYCCTTAATG
Associated Phenotype:
Not determined