Busch Lab

ZMP

zgc:113333

Ensembl ID:
ENSDARG00000038242
ZFIN ID:
ZDB-GENE-050320-57
Description:
hexosaminidase D [Source:RefSeq peptide;Acc:NP_001013509]
Human Orthologue:
HEXDC
Human Description:
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing [Source:HGNC Symbol;Acc:2
Mouse Orthologue:
Hexdc
Mouse Description:
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing Gene [Source:MGI Symbol;A

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11180 Nonsense Available for shipment Available now
sa19979 Essential Splice Site Available for shipment Available now
sa6881 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11180
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055766 Nonsense 168 471 5 11
ENSDART00000130029 Nonsense 168 573 4 13
ENSDART00000145277 Nonsense 168 254 6 8
ENSDART00000145539 None None 36 None 4
Genomic Location (Zv9):
Chromosome 3 (position 18572970)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18601332
GRCz11 3 18751072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTCACAAAAAGTCCGGAAGATRTAGAGGAAATTAAGTCTCTGGCTAAA[C/T]GACAYAATCTGGAACTGATACCTTTGGTGCAGGTGTTTGGACACATGGAG
Long Flanking Sequence:
CACAAAAAAATTCAACTAAATTTTTCCATTTATTTATCTTCCCTCGATTTTTCTCCTTTTTAAATTTGTATTTAATATTGTTCTATAACATAAATTTGGGTGCACAATTTTTTGATCTATTAACAGCTATCTAACAGTTATTGGCAAGTTATTAAATATAATATATTGTAGAGCTTCCTATTAAAAATGTGGATTAAAAAATAAATTTGTAAGGGGTGTACTTATATGCCGAGGAGCAATGTATATCAAACTTCTAAAATGTAAAAAAAAAAAATATTGCTAATACATTTGAAAGTTTAAGTAAATATCTATTGAAGCTTCCTCTGTAACTCTAAGCCTTTCAATTCATGGATAAAATGTTGCTAAAATATATTTAGAGATCATAAGTTGACAGTTTCTATGCATGTATTTTTATGAATGCAGTATATTTATCACTTGTTTGTCTTTTATTGTTCACAAAAAGTCCGGAAGATATAGAGGAAATTAAGTCTCTGGCTAAA[C/T]GACACAATCTGGAACTGATACCTTTGGTGCAGGTGTTTGGACACATGGAGGCAAGTAGAGATTTTATCAACAAAAAATCTCAAATATGTGCATACTACATACTTCAGTGCAGTGCTAAAGAGGCATTTACATTTTGTTTTACAAGTGGATTCTTTACATAATGTCTAGTTCAACCATTTCTGATAAATGTGTGGAGGCAAAAATCATTCAAATGCTGTGGATGCGTTGCAGCTCTGCTTAACCAGGCTTTCTGTTCACATTTCAGTTCGTCTTAAAACATGAAAAGTATTTTAAATTGAGAGAAGTGGAAACGTTTCCCAATAGTCTAAACTCTCTGGCCCAAGGAAGCATGGAACTCGTTCAAAACATGCTAATGCAGGTTATGAAGAAGCACCCAGAAGCACGGTGGTTCCACATTGGTGCCGATGAGGTCTGTGGATTTCTATTCTTTGCAGATCAGAATTATAAAGACATAAATATAACCATAATAATCATTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19979
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055766 Essential Splice Site 325 471 8 11
ENSDART00000130029 Essential Splice Site 325 573 7 13
ENSDART00000145277 None None 254 None 8
ENSDART00000145539 None None 36 None 4
Genomic Location (Zv9):
Chromosome 3 (position 18570337)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18598699
GRCz11 3 18748439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCCATGATATGGAACTACCATGCAAACTTGAACGTGAAGGACATTGG[T/A]AAGGCCTGGCTCTGTTACTTATACCTTAATAAGGTCAATATGAACAATCT
Long Flanking Sequence:
CGTTAGCATCAGTAGCATTCGAGAGTCTGAGTGCTGCCTCGATTGCGTCCTATTTTAGACACTTGCATTTTTCAATCATTAAAGTTTGGCTAGGTTGTAACATAATTTTTCTGTTAAGTGACAAACACAGAACACTCTGAATTGGATTGTTGCCCAAACATGTATGGCTGTAAAAAACTAATTAAGCTAACGTTATATCGTTAGCAACAGTAGCATTCGAGAGCAGTCTGAGCGTGGCCTCGAGTGCGTCCTATTTTAGACACTTGCATTTTTCAATCATTAAAATTTGGCTAGGTTGTAACATGATTTTTTTGTTGAGCGACAAACACAGAACACACTTTTTAATATCACTTAAAAAACACACACACAACGTCACCATAACTGGAAAGCACATTTTTGACCCTGACATGATTTTTTCCCTTTTCAGAATCAGGTTTGCAAGATCTTGCTTCACCCATGATATGGAACTACCATGCAAACTTGAACGTGAAGGACATTGG[T/A]AAGGCCTGGCTCTGTTACTTATACCTTAATAAGGTCAATATGAACAATCTTACCCAATTACCCATTAGCTTAAAATATCTTCCTTATTTTGAACGGAGTTCTTATACCCATGAGAAAATAAAATTTTGATTTAATAATCTTTTTCTTGTATTTTAATCAAATAAATACAGTCTTTGTAAGCTCTGTGACTAGGTCCGTCATGATATCTAATTTTTGTTGTACAATATATTGCACCAAAATGTATTGCGATAAACAACATTATTGTTATTTTAAAGCAGCTATGATAAATCATCTTTTGTAAGCTGTTTAGACAGAACTGTGTGTAGGTATAGTGTGTCCACAGACATATTTGGGTGGTATAAACACAATAAGTCTTCTTTTTTTTTTTTTTTTCCTGACGTTAAAATAGGATGCAAATTCCTCCCATTTTGAGGCCCACCACAACATGGTGAAGGATAATTATATCAATGAGACAGGACGTCCACAAAGCGACCAGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6881
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055766 None None 471 None 11
ENSDART00000130029 Essential Splice Site 508 573 None 13
ENSDART00000145277 None None 254 None 8
ENSDART00000145539 Essential Splice Site None 36 None 4
Genomic Location (Zv9):
Chromosome 3 (position 18563530)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18591892
GRCz11 3 18741632
KASP Assay ID:
554-5021.1 (used for ordering genotyping assays)
KASP Sequence:
AAGYGCATAAACAGAGATGGAGTAAGCTAATATTTCTCCTTTTTTATGTC[A/T]GAATGATGGATGAAWGGGATTCCTTTTTGCTGACTTTTCGGGAAARCATG
Long Flanking Sequence:
GTGTAGTAAATGAGGACAGAATTTGCATGTAAGGGTGAATTATTCCTTAAATGAGCTGGCCTGACAGATTTTATGCAAAGGTCATGGAAATGTTGTGGGATCCCTGTATGTCTGCAAGCAGAAGTAGGAGATAAAGGGGTAATTCACCCAAAAATAAAAACATACTCACCATTTACTCGCCCTCAAGTGGTTCCAAATGTTTATGAGTGTTTAATACTAAACACAAAGGAAGACATTTTAAAAAACGTTGGAAACTGATAACCACTGACATCTATAGAAGTTTTATTTCATACTATGGATGTCAATGGTAGCCGGTTTTCCAACATTTTTCAAAATGTCTTCTTTTGTATTGAAGAAAGAAATAAGTGGGCGTGAGAAACTGGCAGTTTTAATTTTGTGGTGAACGATCCTTTTAAATGACTGTGATCTTGATGATGTGTTTATGAAATAAAGTGCATAAACAGAGATGGAGTAAGCTAATATTTCTCCTTTTTTATGTC[A/T]GAATGATGGATGAATGGGATTCCTTTTTGCTGACTTTTCGGGAAAGCATGGAGGCGATTTTTTACCCGGACACTTTAGAGGAGTGGTTGGAAGAGAACGTGAATGAACACATTGAAACGCTTCACAACATGGTGGTTGATGTAGAGCGGATCATTAAACTCAACGGACAGCCAAAGGTGGACCCCTTGGAAAATAGGTGAAACAAATCGGTGTAAAAGACATTCCAAACATGGCATTCAGACCTCTTGTTTCTGCACAAAAGGAGGTGTTTCCCCTCTCAGGGACCTTGCTTATTACCTTAGGACTTTACTGGAAGTGACGAACACATATATTATATATGAACTGCTTGAAAAAATGAATTCACAACGTTGCATTGATGTGTTTATTTAATCGGTTTTTGAGTGGACTTTGCTAAAGATTTAGCTGTAAAGGGATGAAATGCAATCATGCATAAATTAATGTTTTTTATAACTGTGGTCTGAGGAGCACAAATATTGTGC
Associated Phenotype:
Not determined