Busch Lab

ZMP

si:ch211-225g23.2

Ensembl ID:
ENSDARG00000038219
ZFIN ID:
ZDB-GENE-091117-6
Human Orthologue:
FNBP1
Human Description:
formin binding protein 1 [Source:HGNC Symbol;Acc:17069]
Mouse Orthologue:
Fnbp1
Mouse Description:
formin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109606]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37226 Nonsense Mutation detected in F1 DNA Not yet available
sa17043 Nonsense Available for shipment Available now
sa18638 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37226
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065862 None None 639 None 18
ENSDART00000132002 Nonsense 65 562 4 14
Genomic Location (Zv9):
Chromosome 21 (position 6227717)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6201921
GRCz11 21 6307429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATGTTGTATTAATGATGAATGTGTTTGTTTGTGTGTGTGTGTCAGATA[T/A]ACGTGGTGCCGTGCATTTCATTCAACGTTGAACGAGCTGAACGATTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17043
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065862 Nonsense 246 639 8 18
ENSDART00000132002 Nonsense 246 562 8 14
Genomic Location (Zv9):
Chromosome 21 (position 6294380)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6232716
GRCz11 21 6338224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACGTTTGCGGAGGTGGACCGACAGATTCTGCCCATCATTGGGAAATG[T/A]CTGGATGGAATGACACAAGCRGCCGAGTCCATTGAATCCAAGACTGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18638
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065862 Nonsense 331 639 10 18
ENSDART00000132002 None None 562 None 14
Genomic Location (Zv9):
Chromosome 21 (position 6305713)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6244049
GRCz11 21 6349557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYGCTGCTCTCTCTGTGGCTCGTGTCTTTACCGGTAGCTTATGTCCCTGT[T/A]AACGTCCCCCGTACCTCGCCAGCCCCCCCCTGACCCCCCCTCACCTTCTG
Associated Phenotype:
Not determined