Busch Lab

ZMP

RELN (3 of 4)

Ensembl ID:
ENSDARG00000038188
Description:
reelin [Source:HGNC Symbol;Acc:9957]
Human Orthologue:
RELN
Human Description:
reelin [Source:HGNC Symbol;Acc:9957]
Mouse Orthologue:
Reln
Mouse Description:
reelin Gene [Source:MGI Symbol;Acc:MGI:103022]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29104
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055678 Essential Splice Site 318 1061 6 22
Genomic Location (Zv9):
Chromosome 18 (position 49778169)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50934098
GRCz11 18 50868208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGCCGACGGGAGGCTCGCACCGCACCGCTGGACACCACACACACACGG[T/G]CAGTGCACACTCATACGCACACCACTGGACACGACACACACACACACAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7868
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055678 Nonsense 411 1061 10 22
Genomic Location (Zv9):
Chromosome 18 (position 49779028)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50934957
GRCz11 18 50867349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGTGTGGGTGTTGGATGACCTGCTGCTGGACGGAGACTCCCTCAGC[A/T]GAGCGCCGCTGGTRCTGGACGGCTTTGAGTCCGGCCCGCAGGAGCAGAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29105
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055678 Essential Splice Site 893 1061 19 22
Genomic Location (Zv9):
Chromosome 18 (position 49781611)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50937540
GRCz11 18 50864766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTACAACAAGTGGGGCAGAGTTACTCTACCCATACCACACTACGCCAG[G/A]TAAACACACACACACACACACACACACCTGCTCAAGGGAAACACAGAGCT
Associated Phenotype:
Not determined