Busch Lab

ZMP

dusp11

Ensembl ID:
ENSDARG00000038156
ZFIN ID:
ZDB-GENE-050417-226
Description:
RNA/RNP complex-1-interacting phosphatase [Source:RefSeq peptide;Acc:NP_001017722]
Human Orthologue:
DUSP11
Human Description:
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) [Source:HGNC Symbol;Acc:3066]
Mouse Orthologue:
Dusp11
Mouse Description:
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene [Source:MGI Symbol;Acc:MGI:1919

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21812 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21812
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055632 Nonsense 142 178 6 9
ENSDART00000099259 Nonsense 142 197 6 8
ENSDART00000134890 Nonsense 142 328 6 10
Genomic Location (Zv9):
Chromosome 10 (position 43506617)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42313112
GRCz11 10 42141492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGGTGTTCATTGTACACATGGTTTGAACCGCACCGGTTATTTAATATG[T/A]CGGTAAGTACGTTTCTTTTCTCATTGTGAAGTGCTGCCGGCTGTGTTCGT
Associated Phenotype:
Not determined