Busch Lab

ZMP

si:dkeyp-94b4.1

Ensembl ID:
ENSDARG00000038138
ZFIN ID:
ZDB-GENE-081104-483
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIQ7]
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa41992 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6243 Nonsense Mutation detected in F1 DNA Not yet available
sa35237 Nonsense Mutation detected in F1 DNA Not yet available
sa16034 Nonsense Available for shipment Available now
sa35238 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41992
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Essential Splice Site 225 1459 5 28
ENSDART00000143924 Essential Splice Site 225 418 6 8
ENSDART00000144727 Essential Splice Site 81 201 5 6
Genomic Location (Zv9):
Chromosome 12 (position 16614972)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15725937
GRCz11 12 15768244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGAGGATGCAAGCAACAAGGATGTTGGGAATGCAAGAGATCAAATGG[T/C]AAGCAGTTATTGTACACATCAGTCATTGTACGCAACCTAAATTAAAGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2663
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 293 1459 6 28
ENSDART00000143924 Nonsense 293 418 7 8
ENSDART00000144727 Nonsense 149 201 6 6
Genomic Location (Zv9):
Chromosome 12 (position 16618389)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15729354
GRCz11 12 15771661
KASP Assay ID:
2260-5158.1 (used for ordering genotyping assays)
KASP Sequence:
GCATCCTAAAGAAGAGCCGTTCAACCAGYCTGGATTTAGAACCTGGTGAA[C/T]AAGAGCGAACCACTATCTGCAAGGAGCTGACTGTTGTTGATGGAAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6243
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 295 1459 6 28
ENSDART00000143924 Nonsense 295 418 7 8
ENSDART00000144727 Nonsense 151 201 6 6
Genomic Location (Zv9):
Chromosome 12 (position 16618395)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15729360
GRCz11 12 15771667
KASP Assay ID:
554-5168.1 (used for ordering genotyping assays)
KASP Sequence:
TAAAGAAGAGCCGTTCAACCAGYCTGGATTTAGAACCTGGTGAAYAAGAG[C/T]GAACCACTATCTGCAAGGAGCTGACTGTTGTTGATGGAAATGAAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35237
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 601 1459 12 28
ENSDART00000143924 None None 418 None 8
ENSDART00000144727 None None 201 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16638452)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15749417
GRCz11 12 15791724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGGCATCTGCAGTTGAGGAACACAAGCGTTCAGTGCGGCCATGCAGA[C/T]GAGCCAAGAGCTCAAGAAACCCTCTTCGTGCCCTGGCAGCACGAGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16034
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 799 1459 16 28
ENSDART00000143924 None None 418 None 8
ENSDART00000144727 None None 201 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16645194)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15756159
GRCz11 12 15798466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTCTTGTGTTTTACAGGTGCAGGGGAGCYGGGGGAAGATGAACTCTA[C/A]GAGAGTGCTATAATAGAGTCAAACTGTGTTTATAGGCTGKTGGAGGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35238
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Essential Splice Site 896 1459 17 28
ENSDART00000143924 None None 418 None 8
ENSDART00000144727 None None 201 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16645617)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15756582
GRCz11 12 15798889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGAGTCAACCCCCTTGATCCCTCTTCAGCCAATAAAGACAATGCTAAG[T/C]GAGTGGCATCTTCAATCTTTGTAATTACAGCTTGTATTGGTGATCTACGT
Associated Phenotype:
Not determined