Busch Lab

ZMP

gnrhr4

Ensembl ID:
ENSDARG00000038116
ZFIN ID:
ZDB-GENE-050419-76
Description:
gonadotropin releasing hormone receptor 4 [Source:RefSeq peptide;Acc:NP_001091663]
Human Orthologue:
GNRHR
Human Description:
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa366 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29041
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055567 Nonsense 148 406 1 3
Genomic Location (Zv9):
Chromosome 18 (position 25184255)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25414028
GRCz11 18 25400560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTACTCCTGTGCATTTGTGACCGTGGTCATAAGCCTAGACAGACAGT[C/A]GGCCATTCTCAACCCTCTGGCCATTAATAAGGCTAAGAAGAAGAACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa366
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055567 Nonsense 330 406 3 3
Genomic Location (Zv9):
Chromosome 18 (position 25175097)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25404870
GRCz11 18 25391402
KASP Assay ID:
554-0236.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCTGTTTATTTTTGGACTGTTTAATGCAATCCTGGATCCCATCACTTA[C/A]GGCCTCTTCACCATCCACTTTCGCAAAGGACTGAAGCGCTACTGTCGCAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461