Busch Lab

ZMP

smurf2

Ensembl ID:
ENSDARG00000038067
ZFIN ID:
ZDB-GENE-030131-1830
Description:
E3 ubiquitin-protein ligase SMURF2 [Source:UniProtKB/Swiss-Prot;Acc:A9JRZ0]
Human Orthologue:
SMURF2
Human Description:
SMAD specific E3 ubiquitin protein ligase 2 [Source:HGNC Symbol;Acc:16809]
Mouse Orthologue:
Smurf2
Mouse Description:
SMAD specific E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1913563]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20009 Nonsense Available for shipment Available now
sa20008 Essential Splice Site Available for shipment Available now
sa16471 Nonsense Available for shipment Available now
sa16413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20009
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055491 Nonsense 421 765 12 20
Genomic Location (Zv9):
Chromosome 3 (position 25398454)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25166639
GRCz11 3 25297187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCTCAGGCAGGACACTGCCGCATCGAGGTCTCACGCGAGGAAATCTTT[G/T]AGGTCAGACCCCAAACTTGCTCTGTGTAAAATTTCTGCATAAAAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055491 Essential Splice Site 421 765 12 20
Genomic Location (Zv9):
Chromosome 3 (position 25398450)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25166635
GRCz11 3 25297183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGCAGGACACTGCCGCATCGAGGTCTCACGCGAGGAAATCTTTGAGG[T/G]CAGACCCCAAACTTGCTCTGTGTAAAATTTCTGCATAAAAATAATTCCGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3439
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055491 Nonsense 562 765 16 20
Genomic Location (Zv9):
Chromosome 3 (position 25391107)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25159292
GRCz11 3 25289840
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCCTCTATCTGTTTTTNGTGTTCAGAGATAATGACATCACCGGGGTGT[T/A]GGACCACACGTTCTGCGTTGAACAYAATGCATATGGAGAGATCATTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16471
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055491 Nonsense 605 765 17 20
ENSDART00000055491 Nonsense 605 765 17 20
Genomic Location (Zv9):
Chromosome 3 (position 25390892)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25159077
GRCz11 3 25289625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTGGGTGTCATCAAATGTCCTGTTTCTGCGCAGGCTGTATGTGAACT[G/A]GCGGTTCCTGAGGGGCATCGAGGCTCAGTTCCTGGCCCTGCAGAAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16413
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055491 Nonsense 605 765 17 20
ENSDART00000055491 Nonsense 605 765 17 20
Genomic Location (Zv9):
Chromosome 3 (position 25390892)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25159077
GRCz11 3 25289625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTGGGTGTCATCAAATGTCCTGTTTCTGCGCAGGCTGTATGTGAACT[G/A]GCGGTTCCTGAGGGGCATCGAGGCTCAGTTCCTGGCCCTGCAGAAAGGCT
Associated Phenotype:
Not determined