Busch Lab

ZMP

si:ch211-149k23.9

Ensembl ID:
ENSDARG00000038052
ZFIN ID:
ZDB-GENE-100922-15
Human Orthologue:
AC027045.1
Human Description:
Putative germ cell-specific gene 1-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A8MUP6]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa28610 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa802 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa28610
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055465 Essential Splice Site 81 246 4 8
ENSDART00000140946 None 4 260 1 5
Genomic Location (Zv9):
Chromosome 16 (position 15649831)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14008290
GRCz11 16 13898410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGAGGAACTTGCCAGGATTCGCCAAAGGCAATTAGCCAATGCAGTGCA[G/A]TACATCTGGGAGACGGGAGAAGACAAGTACACCTTCAGATATTTCCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa802
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055465 Nonsense 101 246 4 8
ENSDART00000140946 Nonsense 25 260 1 5
Genomic Location (Zv9):
Chromosome 16 (position 15649892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14008351
GRCz11 16 13898471
KASP Assay ID:
554-0707.1 (used for ordering genotyping assays)
KASP Sequence:
AGACGGGAGAAGACAAGTACACCTTCAGATATTTCCACACAGGATTCTGG[C/T]AGTCTTGCGAAAAACATGCTGATGGTAAGAAAAAGTCTCATGAAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28611
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055465 Essential Splice Site 125 246 5 8
ENSDART00000140946 Essential Splice Site 49 260 2 5
Genomic Location (Zv9):
Chromosome 16 (position 15653841)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14012300
GRCz11 16 13902420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAACGATGTCGTCGGTTCATGGATCTCACTCCTGGAGAGACTCATGG[T/G]AAGATGATTCCTGCAAAATTATATAATGATATCATAGTAATTCATTCATT
Associated Phenotype:
Not determined