Busch Lab

ZMP

flr

Ensembl ID:
ENSDARG00000038024
ZFIN ID:
ZDB-GENE-070117-2066
Description:
Tetratricopeptide repeat protein 30A [Source:UniProtKB/Swiss-Prot;Acc:A7YE96]
Human Orthologues:
TTC30A, TTC30B
Human Descriptions:
tetratricopeptide repeat domain 30A [Source:HGNC Symbol;Acc:25853]
tetratricopeptide repeat domain 30B [Source:HGNC Symbol;Acc:26425]
Mouse Orthologues:
Ttc30a1, Ttc30a2, Ttc30b
Mouse Descriptions:
tetratricopeptide repeat domain 30A1 Gene [Source:MGI Symbol;Acc:MGI:1926052]
tetratricopeptide repeat domain 30A2 Gene [Source:MGI Symbol;Acc:MGI:3700200]
tetratricopeptide repeat domain 30B Gene [Source:MGI Symbol;Acc:MGI:1919671]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40077 Missense, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1163
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055422 Essential Splice Site 18 651 1 19
ENSDART00000108973 Essential Splice Site 18 556 1 18
Genomic Location (Zv9):
Chromosome 3 (position 28982796)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 28700835
GRCz11 3 28831677
KASP Assay ID:
554-1073.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAATGACGATTAAAGACGGCGAATACACGGCCACCGTGTACAAAATGG[T/A]GAGTTCTTAGCTGCACAAGCTAACAGGCTAACCTTARTTTAGTTAACGTT
Long Flanking Sequence:
GAGCAATCTTTAGTAATTCCATATAGTACATCTTGTAATGTAAAAGTCAAACCTTCAGCATCCACGTTTTTTATTATCAACCAGTCTTGTACTTTTTTCCAAAATGATTGAACGGCGTTGCAAGAGAAAAATATGTGTTCTGTGTCTTCACTAAAGTGTTTACATAAATGGCATGGTGAGTTTTCTAAGTTGAATTTTAGGTGTAAGAATCTATTAGAAGGGTATATATCATTTAATATTTTAAATTGTACTTCTTTTTGTTGATGTTTTTAAGCTCTGGGAAGCGTCATGTATTGATTACGTCACTTCCGTTTCTTGGACGGTTGCTAAGCGACATGATGTCTGCGTCGTTCCACTGAAAACATTCAGCGCTGCATCTTCAACTTTACAAAAAAAATACGTTTTTGTTTATGGAGTAAAGCTGCATGAAGCGTTGGGTTCAATAATGCCGCCAATGACGATTAAAGACGGCGAATACACGGCCACCGTGTACAAAATGG[T/A]GAGTTCTTAGCTGCACAAGCTAACAGGCTAACCTTAATTTAGTTAACGTTTCATCTTCTCTCATCTGCTGTTTGATTTCATCCGCGTTTTAAAATAAGCGACAGGCATTTTATGGAATTTCTGGCTTTTATTAATTTATACCTATGTCTTTGTAAGATTAAAGAAGGGCGATATGGAGACGCAATTCATATCCTGAGCAAAGAACATCAGAAACACACTAAAGTAAGTTAGACTGCACCAATTCTTTATCTGTTAACATCCAAATACGATCTAACTGTAACCATACTAACTCTTAATAACATCAATAGCAATATATTATTACTGCATATATTATTTAACGTTATTGTTATTATACTGGGATTTATATACAGCTAACGTTATGGTAAAATAATTATGAGGCCACTTGAACATCCACAGTTTCTATGGACTTGTTTTATTTTATAAAGGTCTTTCTAGATAACATTTTTTTGTCTAGTAATCAGTCATCATATAATTATTTA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055422 Missense 566 651 18 19
ENSDART00000108973 Nonsense 536 556 17 18
Genomic Location (Zv9):
Chromosome 3 (position 28999207)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 28717246
GRCz11 3 28848088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTTATTTTCGCTTGGCATGACACTGACGTCCTGTTTTTCAGCTTGGAA[C/T]AGACACATGGTTCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACA
Long Flanking Sequence:
CTCTATTTTTCAAAGTCTTGCTCAAATTCCATTATGTTATTTTAGTGTATTCACAAATACAGACGTGGACAAATTAGTTTGTACTCTTCCATTGAGATATATGAGTGAAAAACTGATAAAATAAGTGAATAGGTAATAATTAATACAAAATGATTCTAAACTGAAAATAAACTAATGAAAATCTGATATTTCTTTTGAATTGTGGTTCAACAGAAGCATTAAAATAGGAAAACTAATGAAACTGGCCTGGACACAATCGAAGAGTACCAACAACTTTGTCCACATCCGTATCTATCCTAGAGCTCTGTCCAGCTGCATAAACAGTGTTACATAACATTCTGGTTCTCACAACAGTGTAGCAGATGCACTGTCTTTGCCTTTTTAGACTTAACTTTTTATCAACTTGATGTTTACCAGTTTTACTGGTGTGATTTTTCATGTGATGTTACTTAGTTATTTTCGCTTGGCATGACACTGACGTCCTGTTTTTCAGCTTGGAA[C/T]AGACACATGGTTCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACATGGCCAAGCACATGATCATGCTCAGAGATTCAGTAGTGCAAGAGTGCATTCAGTTCCTTGAGCACTGTGAATGTAAGTATATGGTATCTTAAAGCACCAGCCTATTAGAGGGCCGCAAGATGACTTTAAAATAAGACAAAATATGATTGAAAATAAGCTAAAACGAAAGGTAATTGATTCAATCTAGACTTGTGATTTTTATTTAAGAACAAGAGATGTTAAAATGTAGGTTTTAAACTTCAATACTAGTTATATTAAGCTCTAAATTATTTTATAAGCCACTGTAGAATTACAGTATTAAAAAATCTTAAAGGTCACATGAAATTAAAATTAAAAAGAATTTAATGGTAATTTCATGCTGTTAGTTTTAAGGATGTCTATAGACTATTTTAATGTAGTCATGCCATTGGCCCTTGAACATTTCCTGCGAGTTCAAACTATTTCATAACT
Associated Phenotype:
Not determined