Busch Lab

ZMP

fus

Ensembl ID:
ENSDARG00000037968
ZFIN ID:
ZDB-GENE-040426-1010
Description:
RNA-binding protein FUS [Source:RefSeq peptide;Acc:NP_957377]
Human Orthologue:
FUS
Human Description:
fused in sarcoma [Source:HGNC Symbol;Acc:4010]
Mouse Orthologue:
Fus
Mouse Description:
fusion, derived from t(12;16) malignant liposarcoma (human) Gene [Source:MGI Symbol;Acc:MGI:1353633]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15506 Nonsense Available for shipment Available now
sa33220 Nonsense Mutation detected in F1 DNA Not yet available
sa40098 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15506
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055340 Nonsense 52 541 3 15
ENSDART00000075244 Nonsense 52 237 3 9

The following transcripts of ENSDARG00000037968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32837760)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32569070
GRCz11 3 32700784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGCTATGGAGGATACAACCAARGCTCAGAGAGCAGCTCCGCTCCTTA[T/A]AATCAGGGAGGATACAGCTCCAACTATGGACAGTCCCAGTCAGGTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33220
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055340 Nonsense 140 541 5 15
ENSDART00000075244 None None 237 None 9

The following transcripts of ENSDARG00000037968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32839432)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32570742
GRCz11 3 32702456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCTATAGCAGCAGCTCTCAGTCGTCTGGCTACGGTCAGCAGCAGCAG[C/T]AGAGTGGAGGTGGGTATGGAGGCAGTGGTGGTCAGTCTGGAGGATATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40098
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055340 Essential Splice Site 326 541 None 15
ENSDART00000075244 None None 237 None 9

The following transcripts of ENSDARG00000037968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32845088)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32576398
GRCz11 3 32708112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGTGGACTCTGTTGCAGACTACTTTAAACAGATCGGCATCATCAAGG[T/G]AAAGTGGCAAGGCAAAAAAAAAAACACAGTGATGTGGATGACTCATGGCT
Associated Phenotype:
Not determined