Busch Lab

ZMP

rcn3

Ensembl ID:
ENSDARG00000037961
ZFIN ID:
ZDB-GENE-040625-175
Description:
reticulocalbin-3 [Source:RefSeq peptide;Acc:NP_001002158]
Human Orthologue:
RCN3
Human Description:
reticulocalbin 3, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:21145]
Mouse Orthologue:
Rcn3
Mouse Description:
reticulocalbin 3, EF-hand calcium binding domain Gene [Source:MGI Symbol;Acc:MGI:1277122]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15966 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15966
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055324 Essential Splice Site 136 316 3 8
Genomic Location (Zv9):
Chromosome 3 (position 32677087)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32408397
GRCz11 3 32540111
KASP Assay ID:
2259-3665.1 (used for ordering genotyping assays)
KASP Sequence:
GAAGATCGGATGGATTGAGTACAAGAACACCACCTATGGATATTATATAG[G/A]TAATGAGGCTTTGCGTTTAGGCGTGGSAGCTGGTRATGTTTAATGAGAAA
Long Flanking Sequence:
GCTGCTCTTTCTGGGGACACTTGCCCTGTTTGCTGGGCTCTCGGTTGCGGTGCCAGCACAGGAGAAGCGTATACATCATAAGCTAGACCTCAGTGACCATCCTCACGATGATGCCCACGGTTTCCAGTTTGACCACGAGGCCTTCCTGGGGAAAGAGGAATCCAAGACCTTTGACCAGCTGAGCCCTGAGGAGAGCAAAGACAGATTAGGGTACACTAAAAAAAAGTTAGAATAATGCAGTAATAGGAGAAAACTAAATCATCATGTGTCTTACTTTTGTATTTTTTTTATATATTCCCCATGCAGAAAGATTGTGGATAAGATTGACACAGATAAGGATGGCTTCGTCAGTCATGCTGAGTTACACCACTGGATCAAGCACAGGCAGAGGAGGTACATCGAGGAGAACGTGGACAAGCACTGGAATGAGTACGACCAGAATAAGGATGGGAAGATCGGATGGATTGAGTACAAGAACACCACCTATGGATATTATATAG[G/A]TAATGAGGCTTTGCGTTTAGGCGTGGCAGCTGGTGATGTTTAATGAGAAACAGCTGTTCATGTGTGGTTATAAAACACTGTAGAACCAAAGAATATTAATCGACTTTGTTATTTAATTGCAGACACAGAGTTTGATGATGTGGATGATAAAGCCACCTACAAATCCATGCTTAATAGAGATGAGAGGCGGTTTAAGTCTGCAGACAGGGATGGGGATGGTGTCGCCACCAGAGAAGAGTTCACTGCCTTCCTCCATCCAGAAGAGTTTGACTTTATGAGAGACATTGTGATTCAGGTGAGGTCTGAATAAAGGGAGAGATAGATGAATATAATGATGGAGAAATTAAAAGGACAGATATACAGTTGAAGTCAGAATTATTAGCCCGCCTTTGAATTTTTTTTCTTTTTTAAATATTTCCTAAATGATGTTTAACAGAGCAAGGAAATATTCACAGTGCGTCTGATAATATTTTTTCTTCTGGAGAAAGCCCTATTTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2108
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055324 Essential Splice Site 137 316 4 8
Genomic Location (Zv9):
Chromosome 3 (position 32676966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32408276
GRCz11 3 32539990
KASP Assay ID:
554-2961.1 (used for ordering genotyping assays)
KASP Sequence:
TAAAACACTGTAGAACCAAAGAATATTAATCGACTTTGTTATTTAATTGC[A/T]GACACAGAGTTTGATGATGTGGATGATAAAGCCACCTACAAATCCATGCT
Long Flanking Sequence:
TTCCAGTTTGACCACGAGGCCTTCCTGGGGAAAGAGGAATCCAAGACCTTTGACCAGCTGAGCCCTGAGGAGAGCAAAGACAGATTAGGGTACACTAAAAAAAAGTTAGAATAATGCAGTAATAGGAGAAAACTAAATCATCATGTGTCTTACTTTTGTATTTTTTTTATATATTCCCCATGCAGAAAGATTGTGGATAAGATTGACACAGATAAGGATGGCTTCGTCAGTCATGCTGAGTTACACCACTGGATCAAGCACAGGCAGAGGAGGTACATCGAGGAGAACGTGGACAAGCACTGGAATGAGTACGACCAGAATAAGGATGGGAAGATCGGATGGATTGAGTACAAGAACACCACCTATGGATATTATATAGGTAATGAGGCTTTGCGTTTAGGCGTGGCAGCTGGTGATGTTTAATGAGAAACAGCTGTTCATGTGTGGTTATAAAACACTGTAGAACCAAAGAATATTAATCGACTTTGTTATTTAATTGC[A/T]GACACAGAGTTTGATGATGTGGATGATAAAGCCACCTACAAATCCATGCTTAATAGAGATGAGAGGCGGTTTAAGTCTGCAGACAGGGATGGGGATGGTGTCGCCACCAGAGAAGAGTTCACTGCCTTCCTCCATCCAGAAGAGTTTGACTTTATGAGAGACATTGTGATTCAGGTGAGGTCTGAATAAAGGGAGAGATAGATGAATATAATGATGGAGAAATTAAAAGGACAGATATACAGTTGAAGTCAGAATTATTAGCCCGCCTTTGAATTTTTTTTCTTTTTTAAATATTTCCTAAATGATGTTTAACAGAGCAAGGAAATATTCACAGTGCGTCTGATAATATTTTTTCTTCTGGAGAAAGCCCTATTTGTTTTATTTTGGCAAGAATAAAAGCAGTTTAAACATTTTTAAACATCATTTTAAGGTCAAAATTATTAGCCCCTTTAAGCGCTCTATTTATATTTTTATTGTTTACAGAATAAACCATTAATATA
Associated Phenotype:
Not determined