Busch Lab

ZMP

prl

Ensembl ID:
ENSDARG00000037946
ZFIN ID:
ZDB-GENE-030513-1
Description:
prolactin [Source:RefSeq peptide;Acc:NP_852102]
Human Orthologue:
PRL
Human Description:
prolactin [Source:HGNC Symbol;Acc:9445]
Mouse Orthologues:
Prl, Prl2a1, Prl2b1, Prl2c1, Prl2c2, Prl2c3, Prl2c5, Prl3a1, Prl3b1, Prl3c1, Prl3d1, Prl3d2, Prl3d3, Prl4a1, Prl5a1, Prl6a1, Prl7a1, Prl7a2, Prl7b1, Prl7c1, Prl7d1, Prl8a1, Prl8a2, Prl8a6, Prl8a8, Prl8a9
Mouse Descriptions:
Prolactin family 2, subfamily c, member 1 Gene [Source:MGI Symbol;Acc:MGI:3649927]
prolactin Gene [Source:MGI Symbol;Acc:MGI:97762]
prolactin family 2, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861446]
prolactin family 2, subfamily b, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861444]
prolactin family 2, subfamily c, member 2 Gene [Source:MGI Symbol;Acc:MGI:97618]
prolactin family 2, subfamily c, member 3 Gene [Source:MGI Symbol;Acc:MGI:1341833]
prolactin family 2, subfamily c, member 5 Gene [Source:MGI Symbol;Acc:MGI:1858413]
prolactin family 3, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914250]
prolactin family 3, subfamily b, member 1 Gene [Source:MGI Symbol;Acc:MGI:97607]
prolactin family 3, subfamily c, member 1 Gene [Source:MGI Symbol;Acc:MGI:1351649]
prolactin family 3, subfamily d, member 1 Gene [Source:MGI Symbol;Acc:MGI:2660935]
prolactin family 3, subfamily d, member 1 Gene [Source:MGI Symbol;Acc:MGI:97606]
prolactin family 3, subfamily d, member 3 Gene [Source:MGI Symbol;Acc:MGI:2660938]
prolactin family 4, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1206587]
prolactin family 5, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:106332]
prolactin family 6, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1206579]
prolactin family 7, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1206572]
prolactin family 7, subfamily a, member 2 Gene [Source:MGI Symbol;Acc:MGI:1206571]
prolactin family 7, subfamily b, member 1 Gene [Source:MGI Symbol;Acc:MGI:1922846]
prolactin family 7, subfamily c, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914755]
prolactin family 7, subfamily d, member 1 Gene [Source:MGI Symbol;Acc:MGI:97619]
prolactin family 8, subfamily a, member 1 Gene [Source:MGI Symbol;Acc:MGI:1920494]
prolactin family 8, subfamily a, member 2 Gene [Source:MGI Symbol;Acc:MGI:894281]
prolactin family 8, subfamily a, member 6 Gene [Source:MGI Symbol;Acc:MGI:1332225]
prolactin family 8, subfamily a, member 81 Gene [Source:MGI Symbol;Acc:MGI:1921438]
prolactin family8, subfamily a, member 9 Gene [Source:MGI Symbol;Acc:MGI:1914560]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6902 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa26090 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055299 Essential Splice Site 11 210 1 5
Genomic Location (Zv9):
Chromosome 3 (position 32478978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32210288
GRCz11 3 32342002
KASP Assay ID:
554-4059.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAAACCTGTTCTAGTAATGGCTCAAGGGTCTAGACWATACTTTGCAGG[T/C]ATCTTATCCTCAATCTAAACATTGCCTRTTTTACACTTTATGGCTATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055299 Essential Splice Site 51 210 2 5
Genomic Location (Zv9):
Chromosome 3 (position 32479232)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32210542
GRCz11 3 32342256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTTCAGACAAGCTTCACTATCTCAGCACCTCACTCACCAATGATCTG[G/A]TCAGTAAATGCATTTGTTTACTGTCTTTCGGGTCTATCGTGACTTCCGTT
Associated Phenotype:
Not determined