Busch Lab

ZMP

strada

Ensembl ID:
ENSDARG00000037929
ZFIN ID:
ZDB-GENE-030131-6482
Description:
STE20-related kinase adapter protein alpha [Source:RefSeq peptide;Acc:NP_956205]
Human Orthologue:
STRADA
Human Description:
STE20-related kinase adaptor alpha [Source:HGNC Symbol;Acc:30172]
Mouse Orthologue:
Strada
Mouse Description:
STE20-related kinase adaptor alpha Gene [Source:MGI Symbol;Acc:MGI:1919399]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10477 Nonsense Available for shipment Available now
sa20047 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10477
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055277 None None 213 None 11
ENSDART00000124421 Nonsense 219 399 6 9
ENSDART00000146275 Nonsense 198 378 9 12
Genomic Location (Zv9):
Chromosome 3 (position 32051561)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31782871
GRCz11 3 31914585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAATGGTAACTGTGCTMATTTTTTGCGTATGACAGAATCTTCAGGGATA[T/G]GACTTCCGCTCAGACATTTACAGTTTGGGTATCACTGCATGYGAGTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055277 Missense 185 213 9 11
ENSDART00000124421 Nonsense 311 399 7 9
ENSDART00000146275 Nonsense 290 378 10 12
Genomic Location (Zv9):
Chromosome 3 (position 32051921)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31783231
GRCz11 3 31914945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCGACACACAAACGGGGAGCCCTCGTCCTCCTCTGGGGGAAACCCGTA[C/A]AGCCGTACATTCAGTTCTCACTTTCATGCCTTTGTGGAACTGTGTCTACA
Associated Phenotype:
Not determined