Busch Lab

ZMP

rgs9

Ensembl ID:
ENSDARG00000037925
ZFIN IDs:
ZDB-GENE-060929-92, ZDB-GENE-060929-92, ZDB-GENE-060929-92, ZDB-GENE-060929-92
Description:
hypothetical protein LOC767636 [Source:RefSeq peptide;Acc:NP_001070045]
Human Orthologue:
RGS9
Human Description:
regulator of G-protein signaling 9 [Source:HGNC Symbol;Acc:10004]
Mouse Orthologue:
Rgs9
Mouse Description:
regulator of G-protein signaling 9 Gene [Source:MGI Symbol;Acc:MGI:1338824]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33239 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9502 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8135
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123630 None None 334 None 11
ENSDART00000130128 None None 334 None 12
ENSDART00000130591 Nonsense 386 480 15 17
ENSDART00000131018 Nonsense 386 418 16 17
Genomic Location (Zv9):
Chromosome 3 (position 36384899)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36256183
GRCz11 3 36385583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAGGACAATGGGTCTTACAGTAAAGGGACTGGAGCATCCTCACCGCTA[T/G]GTGCTGGAGGCGGCACAGACTCACATCTTCATGCTCATGAAGAAGGTTTG
Long Flanking Sequence:
GATCAATCTTTTACCAATTAGTTACACTACAAGTGTAAAACAAATCAATTGTTTTGCATCAATTGTGCTAAAAGGTGTTAAGATTTACTAAAGGATACTTTTTTTTTTTTACAAGAACACATACAGTATTGGCTTTAAATTGCTTAAACCCTGAAAATTGCTGCTTGCAGCTACAGCATATTTCTGTTTACTATTCCTATAGGCACTAGAACATGTGTTTCTTTTCATCTACAGGTGAGAATTTAGCTTTCTGGGAAGCTGCTGAGGAGTTAAAATTTGGCTCAGCAGCTACAATGTCAGAAAAAGCTGAACAAGTTTTCAAGTGAGTTTGTATTGCCTTAATGTATGGCAATTTATACAACTGGTCTCTATAGCTGAACATTTCTCTCTTTTTTTAAATTTTGCAGAACGTTTTTGGCCCCAGGAGCTCCACGCTGGATCAACATTGACGGCAGGACAATGGGTCTTACAGTAAAGGGACTGGAGCATCCTCACCGCTA[T/G]GTGCTGGAGGCGGCACAGACTCACATCTTCATGCTCATGAAGAAGGTTTGATCGTATTCTTGGAGAGTTTTTTTTTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAATATAACGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTCTTAGGTTTGGCAATTTGTTGTGACTTTTATCATTTTTTAATTTAGCTGTACTTTATGCTCATGTCAGTTTTAGTCATTTAATTACTGAAACTTATTTTTATAAAAAAGAAACATAACAAAAGCATTGTTCATTTGTGAACTTTTAGGATACCTTTTATCGCTACTTGAAGTCACCAGTTTATAAGGACATACAGAAAAAGGCCATTTCACCTGCACCACACAACTTCACGTAAGTTTTGAAACATTTTTAAAAATGTATAACAGTTTGAAATATTTTCACCAATAATTAATCCTTTAATGCTTTTTCCCTGATTTAATTCTGAATTTATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123630 None None 334 None 11
ENSDART00000130128 Essential Splice Site 229 334 11 12
ENSDART00000130591 None None 480 None 17
ENSDART00000131018 None None 418 None 17
Genomic Location (Zv9):
Chromosome 3 (position 36385023)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36256307
GRCz11 3 36385707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAAT[A/T]TAACGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTCTTAGGTTT
Long Flanking Sequence:
AGTATTGGCTTTAAATTGCTTAAACCCTGAAAATTGCTGCTTGCAGCTACAGCATATTTCTGTTTACTATTCCTATAGGCACTAGAACATGTGTTTCTTTTCATCTACAGGTGAGAATTTAGCTTTCTGGGAAGCTGCTGAGGAGTTAAAATTTGGCTCAGCAGCTACAATGTCAGAAAAAGCTGAACAAGTTTTCAAGTGAGTTTGTATTGCCTTAATGTATGGCAATTTATACAACTGGTCTCTATAGCTGAACATTTCTCTCTTTTTTTAAATTTTGCAGAACGTTTTTGGCCCCAGGAGCTCCACGCTGGATCAACATTGACGGCAGGACAATGGGTCTTACAGTAAAGGGACTGGAGCATCCTCACCGCTATGTGCTGGAGGCGGCACAGACTCACATCTTCATGCTCATGAAGAAGGTTTGATCGTATTCTTGGAGAGTTTTTTTTTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAAT[A/T]TAACGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTCTTAGGTTTGGCAATTTGTTGTGACTTTTATCATTTTTTAATTTAGCTGTACTTTATGCTCATGTCAGTTTTAGTCATTTAATTACTGAAACTTATTTTTATAAAAAAGAAACATAACAAAAGCATTGTTCATTTGTGAACTTTTAGGATACCTTTTATCGCTACTTGAAGTCACCAGTTTATAAGGACATACAGAAAAAGGCCATTTCACCTGCACCACACAACTTCACGTAAGTTTTGAAACATTTTTAAAAATGTATAACAGTTTGAAATATTTTCACCAATAATTAATCCTTTAATGCTTTTTCCCTGATTTAATTCTGAATTTATGCTTTTTAGTTTTATGTTTATTATAAGTAATTTTTCTTGTGTGCTTCTGTCATTTTTAAAAAAAAGTTTTACTTAATGTTAATGTTGAAATATTTTTAATCTTATGGTTATTTAGATACTATTATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123630 None None 334 None 11
ENSDART00000130128 Essential Splice Site 229 334 11 12
ENSDART00000130591 None None 480 None 17
ENSDART00000131018 None None 418 None 17
Genomic Location (Zv9):
Chromosome 3 (position 36385024)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36256308
GRCz11 3 36385708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAATA[T/G]AAYGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTNNNNNGTTTG
Long Flanking Sequence:
GTATTGGCTTTAAATTGCTTAAACCCTGAAAATTGCTGCTTGCAGCTACAGCATATTTCTGTTTACTATTCCTATAGGCACTAGAACATGTGTTTCTTTTCATCTACAGGTGAGAATTTAGCTTTCTGGGAAGCTGCTGAGGAGTTAAAATTTGGCTCAGCAGCTACAATGTCAGAAAAAGCTGAACAAGTTTTCAAGTGAGTTTGTATTGCCTTAATGTATGGCAATTTATACAACTGGTCTCTATAGCTGAACATTTCTCTCTTTTTTTAAATTTTGCAGAACGTTTTTGGCCCCAGGAGCTCCACGCTGGATCAACATTGACGGCAGGACAATGGGTCTTACAGTAAAGGGACTGGAGCATCCTCACCGCTATGTGCTGGAGGCGGCACAGACTCACATCTTCATGCTCATGAAGAAGGTTTGATCGTATTCTTGGAGAGTTTTTTTTTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAATA[T/G]AACGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTCTTAGGTTTGGCAATTTGTTGTGACTTTTATCATTTTTTAATTTAGCTGTACTTTATGCTCATGTCAGTTTTAGTCATTTAATTACTGAAACTTATTTTTATAAAAAAGAAACATAACAAAAGCATTGTTCATTTGTGAACTTTTAGGATACCTTTTATCGCTACTTGAAGTCACCAGTTTATAAGGACATACAGAAAAAGGCCATTTCACCTGCACCACACAACTTCACGTAAGTTTTGAAACATTTTTAAAAATGTATAACAGTTTGAAATATTTTCACCAATAATTAATCCTTTAATGCTTTTTCCCTGATTTAATTCTGAATTTATGCTTTTTAGTTTTATGTTTATTATAAGTAATTTTTCTTGTGTGCTTCTGTCATTTTTAAAAAAAAGTTTTACTTAATGTTAATGTTGAAATATTTTTAATCTTATGGTTATTTAGATACTATTATTATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26110
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123630 None None 334 None 11
ENSDART00000130128 None None 334 None 12
ENSDART00000130591 Nonsense 432 480 17 17
ENSDART00000131018 None None 418 None 17
Genomic Location (Zv9):
Chromosome 3 (position 36387780)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36259064
GRCz11 3 36401252
KASP Assay ID:
2259-3797.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTATTTTGCAATAAAAAGGTCTGTTCTCTTCTGTTGTTCAGTGAAGCG[C/T]AGCTGGAGCAGAACATGAGGAACCGACGGCCGAGCATCAGCCCCATCATC
Long Flanking Sequence:
TGTGTGGCATGACTGGGTGTTGTAGTCCATAACATGGCGGATTTGTAGTTCATGTGAATGTATTTAGCAGCGATCTCCAGAAGTTAAACCGCTGGTGATCGTGACAACTCCTGAGCAATTCATGTGACTTTATTTTCCCTGAGTCATATTTAAGCTGCCATCATCACAAAGTCAGTAATATAAAGTATTAAATACATTTCACTAGTTCAGTACATTTTTCTTGTGCCATTTCTTTGTTGTTACACATAACTAATTGTTCAGTTTTTTTTTTGTTTTACTTTTGTTTGTATTGTGTGCGTTTTTACCAAAATCTGGTTCAATTCCATCTCAGCAGCTCCTTTAGAAATATTATTTCCAGGAAAAAAAACATGACATGTTTAATACTTATTTTCCCCACTGTATATCAATTTCTGGATCAGAAGAAACATAAAACAAATGCCCCCGACCTTGCAGTATTTTGCAATAAAAAGGTCTGTTCTCTTCTGTTGTTCAGTGAAGCG[C/T]AGCTGGAGCAGAACATGAGGAACCGACGGCCGAGCATCAGCCCCATCATCACCTACCAGAAGGAGCAGGAGGAGAAAGCAAAGGCCGCGGCCGCAGCAGGACCCGTCGACATCAAAAAACTGATGGCCAGCAAACTAGACCGCAAATAGGAGACTCGCTGCAAATACTACACCTACAATCTGACGGATAACAATATTTTTTAAAAGTTACCCAGAAATGGTTTAACAGGATAGTTTGCCATATTTGGTCATCTAGTCCGATTTTTTTTCAATCTTACGTCATTACAAAACTGTACAAGTTTCTGTTTTCTGTCGAACAAAGTAGAAGATATTATGAAGAATGTTGCAAACCTGTAACCATTAACAGTAGAAAAAACAAACACTCTATATGTCAATGGCTATCGGTTTCCAGCATTCTTTCAAATTTAAATATACGTGTTCAACAGAATGAAGAAACTCAGTTAGGTCTGGAAAAACAGACAGTCAGTAAATAAAGACTCT
Associated Phenotype:
Not determined