Busch Lab

ZMP

rbbp6l

Ensembl ID:
ENSDARG00000037919
ZFIN ID:
ZDB-GENE-040930-5
Description:
retinoblastoma-binding protein 6 isoform 2 [Source:RefSeq peptide;Acc:NP_001003873]
Human Orthologue:
RBBP6
Human Description:
retinoblastoma binding protein 6 [Source:HGNC Symbol;Acc:9889]
Mouse Orthologues:
AC099701.1, AC158570.1, Gm9343, Rbbp6
Mouse Descriptions:
predicted gene 9343 Pseudogene [Source:MGI Symbol;Acc:MGI:3645198]
retinoblastoma binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:894835]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa33231 Essential Splice Site Available for shipment Available now
sa33232 Nonsense Mutation detected in F1 DNA Not yet available
sa33233 Nonsense Mutation detected in F1 DNA Not yet available
sa13575 Nonsense Available for shipment Available now
sa20073 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33231
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266 None None 142 None 3
ENSDART00000102994 Essential Splice Site 314 1631 9 21
Genomic Location (Zv9):
Chromosome 3 (position 35500624)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35285820
GRCz11 3 35415328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCAGATGTATCCCCCGATGCCTTGATTGCAAACAAATTCTTGCGCCAA[G/A]TAAGATATCCTTGTTTTAATTGTTGGTTAGCACATGTCTCTAGTTTTTAT
Long Flanking Sequence:
ACAGTGGAATATATGCCATTCCTACTATTGATGCGTGAGTATGCTTGGCCTTGCTGTAAATGATTGTGATAATTTCTTGTTTACTTGTAGTATACTTGTAGTTTACTTTGTAGTTTTTAATTATATTTTGCTTGCTATGTATAGTGAGGCCTATGCCATTGGCAAAAAAGAAAAGCCACCATTCTTGCCCCAGAATCAGTCCTCATCCTCAGAGGAAGAAGATCCAGTACCTGATGAGCTGCTGTGCTTGATCTGCAAGGATCTTATGACAGATGCTGTGGTTATTCCCTGCTGTGGAAATAGTTACTGTGACGATTGTAAGTGTCTATATCAACAAATGTCAAAAAGGTAAAGTGTTTTTGACCTTGGAAAGCTAAAACTGTATTGTGACCACAGGTATTCGAACATGTTTGCTGGAATCTGAAGAACATGTTTGTCCAACCTGCAAACAATCAGATGTATCCCCCGATGCCTTGATTGCAAACAAATTCTTGCGCCAA[G/A]TAAGATATCCTTGTTTTAATTGTTGGTTAGCACATGTCTCTAGTTTTTATCTAATATTGCAACATTAAGACGACTTTATCATTCTTTTTTTTTTTCAACTTAAGGCAGTGAATAACTTTAAGAATGAAACTGGATATACCAAGAGGATTCGAAAAGCTACAGCTACTCAAGCAGTTGCTCAAGGAGCTCAAAAACAAGCTCCTGCTCAACGTCCTCCTATGAGACGCCAGCAGGATCCTCTGATACCCAGTGTTCCAAGCTCAGCGGCTGATAGCACCCCTCCACAAAGCACACCTGCTGCCCCTTTATCTCCTGTTAGCACTCACGAGCCTTCCAGCACCCCACCTTCTTCCAGCAGCTCTACTGTACACAGCAGCACTGCACCTGCAGGGTCAAACTATAGTCCTGTGGTAAACTCTCCTCCGCACCCTACTAGGCAGGATGACCCTCCTCCATCCAAGTAAGAATTTTATAGCACTTCAGATGATCGCTTGGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33232
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266 None None 142 None 3
ENSDART00000102994 Nonsense 637 1631 15 21
Genomic Location (Zv9):
Chromosome 3 (position 35502110)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287306
GRCz11 3 35416814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCTGCACCTTTTCTATCCAAGGAGGAGTTTTATCGTCAGCAGCGT[C/T]GATTGAAGGAGGAGTAAGTAGTTATTGGGTTTTTAAGTATTGTCTGTAGA
Long Flanking Sequence:
TAGGACCCCAAAGGAGTAGTGGTCAAAGGCCATCTGGAAGTCGTTCTGGATGGGATCCGTAAGTATCAAAGTGTAATCTAATACATTTTAGTTTTAAACAACAAATGTGAAAAATCCTGACTTTTATTTATCCTACCAGGTCCACGAGTAGAGGTAGACTTCAGAGTGAGAGGCCACCAAGAATACAGCCTCAACCAGTGCAAAATCTTCCTCCTGTAGTCCCTCCAGTATTTGTGCCCCCTGCTCTTTTTCCACCTCCTCCACATCCTATGCCACAGCCACCTGTTGTTGTTTCTCAGCAATATCCCATACAATTTCCTCAAGGACAGCAGCCACCACCTCCTTCCTTCAACATTCCTCCTCCTGTATTTCCTCCTGTTCCACCTAATGTGACTGCTCCATGGGTGCCTCCTGGCCCTCAGCCACCTATAGCCAACCCTATCTCTGCTATGCCAGCTGCACCTTTTCTATCCAAGGAGGAGTTTTATCGTCAGCAGCGT[C/T]GATTGAAGGAGGAGTAAGTAGTTATTGGGTTTTTAAGTATTGTCTGTAGAGTATTATTCTTCTTTGCCCGTGCTTATTGTCATTTCTGTTGTAATGTATTTCCAAGGTTTAACTGCAAAGTTTTATTTCCTTCCTGTCTTTGATAAATAGTTCCCAATGTCGATTCGTTACCAGGGAGAAGTCCAAACTTGAGGAGTTCACCAATGACTTTGCCAAAGAGCTTTTGGAGTATAGAAAAATCCAGAAGGAGAGAAGGCGATCCTACTCGAGGTAAAAATTAAATTGACAGATTGACCCACCAAACTGTCAATTTTGTTAAATGATGTCTGGCATCAACTAAATTTTCAATTACATTTTTTCCAGATCCAAATCCCCTTACAGGGGTTCCTCCTACAGTGGTTCTTCATATTCCTATTCAAAATCTCGCTCTCGTTCCAGATCACCTCGCTCCTATTCTCGGTCACTATCCCGATCACGGTCAAGATCCCGTTCACGGTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8132
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266 None None 142 None 3
ENSDART00000102994 Splice Site, Nonsense 642 1631 16 21
Genomic Location (Zv9):
Chromosome 3 (position 35502286)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287482
GRCz11 3 35416990
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCCTTCCTGTCTTTGATAAATAGTTCCCAATGTCGATTCGTTACCAGG[G/T]AGAAGTCCAAACTTGAGGAGTTCACCAATGACTTTGCCAAAGAGCTTTTG
Long Flanking Sequence:
CCAAGAATACAGCCTCAACCAGTGCAAAATCTTCCTCCTGTAGTCCCTCCAGTATTTGTGCCCCCTGCTCTTTTTCCACCTCCTCCACATCCTATGCCACAGCCACCTGTTGTTGTTTCTCAGCAATATCCCATACAATTTCCTCAAGGACAGCAGCCACCACCTCCTTCCTTCAACATTCCTCCTCCTGTATTTCCTCCTGTTCCACCTAATGTGACTGCTCCATGGGTGCCTCCTGGCCCTCAGCCACCTATAGCCAACCCTATCTCTGCTATGCCAGCTGCACCTTTTCTATCCAAGGAGGAGTTTTATCGTCAGCAGCGTCGATTGAAGGAGGAGTAAGTAGTTATTGGGTTTTTAAGTATTGTCTGTAGAGTATTATTCTTCTTTGCCCGTGCTTATTGTCATTTCTGTTGTAATGTATTTCCAAGGTTTAACTGCAAAGTTTTATTTCCTTCCTGTCTTTGATAAATAGTTCCCAATGTCGATTCGTTACCAGG[G/T]AGAAGTCCAAACTTGAGGAGTTCACCAATGACTTTGCCAAAGAGCTTTTGGAGTATAGAAAAATCCAGAAGGAGAGAAGGCGATCCTACTCGAGGTAAAAATTAAATTGACAGATTGACCCACCAAACTGTCAATTTTGTTAAATGATGTCTGGCATCAACTAAATTTTCAATTACATTTTTTCCAGATCCAAATCCCCTTACAGGGGTTCCTCCTACAGTGGTTCTTCATATTCCTATTCAAAATCTCGCTCTCGTTCCAGATCACCTCGCTCCTATTCTCGGTCACTATCCCGATCACGGTCAAGATCCCGTTCACGGTCTCGTTCTCGATCACGCTCCTTCTCTCGCTCACCATACTCCCGCAGGCCTCGAGGTCGAAGTCGTAGCTATCGATCAAGGTCACGCACTCCAACATTCCATCGTTCTCGCAGTAGATCTCCATCATATAGAGGTCGTGAGATGAGTGGGATGGTAAGTGGCATCTACCGTTCCCGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33233
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266 None None 142 None 3
ENSDART00000102994 Nonsense 683 1631 17 21
Genomic Location (Zv9):
Chromosome 3 (position 35502504)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287700
GRCz11 3 35417208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAATTACATTTTTTCCAGATCCAAATCCCCTTACAGGGGTTCCTCCTA[C/A]AGTGGTTCTTCATATTCCTATTCAAAATCTCGCTCTCGTTCCAGATCACC
Long Flanking Sequence:
TGCTCCATGGGTGCCTCCTGGCCCTCAGCCACCTATAGCCAACCCTATCTCTGCTATGCCAGCTGCACCTTTTCTATCCAAGGAGGAGTTTTATCGTCAGCAGCGTCGATTGAAGGAGGAGTAAGTAGTTATTGGGTTTTTAAGTATTGTCTGTAGAGTATTATTCTTCTTTGCCCGTGCTTATTGTCATTTCTGTTGTAATGTATTTCCAAGGTTTAACTGCAAAGTTTTATTTCCTTCCTGTCTTTGATAAATAGTTCCCAATGTCGATTCGTTACCAGGGAGAAGTCCAAACTTGAGGAGTTCACCAATGACTTTGCCAAAGAGCTTTTGGAGTATAGAAAAATCCAGAAGGAGAGAAGGCGATCCTACTCGAGGTAAAAATTAAATTGACAGATTGACCCACCAAACTGTCAATTTTGTTAAATGATGTCTGGCATCAACTAAATTTTCAATTACATTTTTTCCAGATCCAAATCCCCTTACAGGGGTTCCTCCTA[C/A]AGTGGTTCTTCATATTCCTATTCAAAATCTCGCTCTCGTTCCAGATCACCTCGCTCCTATTCTCGGTCACTATCCCGATCACGGTCAAGATCCCGTTCACGGTCTCGTTCTCGATCACGCTCCTTCTCTCGCTCACCATACTCCCGCAGGCCTCGAGGTCGAAGTCGTAGCTATCGATCAAGGTCACGCACTCCAACATTCCATCGTTCTCGCAGTAGATCTCCATCATATAGAGGTCGTGAGATGAGTGGGATGGTAAGTGGCATCTACCGTTCCCGCTCTCGATCCCCCATGTATAGAAATCATAGTCCTGGCAAGAAACTCCCACCACCAGCTCAACTGGAAGGTGAGCGCAAATATACAGGAAGGTACAGAGAACTCCCGCCTTATGATGCTAAGGCTTATTATGGCCGAAACGTAGACCAGAGTGACCCTTATGAAAGAGAGCGATACAGAGAGTGGGAAAGAGAGTACAGAGAGTGGTATGACAAGTATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13575
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266 None None 142 None 3
ENSDART00000102994 Nonsense 778 1631 17 21
Genomic Location (Zv9):
Chromosome 3 (position 35502787)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35287983
GRCz11 3 35417491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGTCGTGAGATGAGTGGGATGGTAAGTGGCATCTACCGTTCCCGCTCT[C/T]GATCCCCCATGTATAGAAATCATAGTCCTGGCAAGAAACTCCCACCACCA
Long Flanking Sequence:
AGAAGTCCAAACTTGAGGAGTTCACCAATGACTTTGCCAAAGAGCTTTTGGAGTATAGAAAAATCCAGAAGGAGAGAAGGCGATCCTACTCGAGGTAAAAATTAAATTGACAGATTGACCCACCAAACTGTCAATTTTGTTAAATGATGTCTGGCATCAACTAAATTTTCAATTACATTTTTTCCAGATCCAAATCCCCTTACAGGGGTTCCTCCTACAGTGGTTCTTCATATTCCTATTCAAAATCTCGCTCTCGTTCCAGATCACCTCGCTCCTATTCTCGGTCACTATCCCGATCACGGTCAAGATCCCGTTCACGGTCTCGTTCTCGATCACGCTCCTTCTCTCGCTCACCATACTCCCGCAGGCCTCGAGGTCGAAGTCGTAGCTATCGATCAAGGTCACGCACTCCAACATTCCATCGTTCTCGCAGTAGATCTCCATCATATAGAGGTCGTGAGATGAGTGGGATGGTAAGTGGCATCTACCGTTCCCGCTCT[C/T]GATCCCCCATGTATAGAAATCATAGTCCTGGCAAGAAACTCCCACCACCAGCTCAACTGGAAGGTGAGCGCAAATATACAGGAAGGTACAGAGAACTCCCGCCTTATGATGCTAAGGCTTATTATGGCCGAAACGTAGACCAGAGTGACCCTTATGAAAGAGAGCGATACAGAGAGTGGGAAAGAGAGTACAGAGAGTGGTATGACAAGTATTTCAAGAATTATAACAACCCACCAAGTGGTCAAATGCGAAGCCGTGTTCCAGGCAGCAGAGATGCCTATAGCCCTGAGCGTTTTGCTCCTCCTCGACCCAGAGAGAACTCCCCCTACAACAGGGGACGCCGAGAGGATTATCCACCACCACCTCAGAGCCACAGTGCCCAATCAAGAGGCAGAGTTGCCATGACATACCAAGAGAAGTGTGCTGAGAAGTTTGGCCACCTTCATGCCAATACCACTGGAACAGGCAGAAGTCTTAACAAAGAGCCTTTGAAACCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20073
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055266 None None 142 None 3
ENSDART00000102994 Nonsense 1441 1631 21 21
Genomic Location (Zv9):
Chromosome 3 (position 35504963)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35290159
GRCz11 3 35419667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAGGCAGTGACCATGGCAGTGAGCGGAGCTCCTCTTCTCAGTCTTCT[A/T]GAGACAGGCAGGCTGATAAAGCTGAACCAAACTCTAGAAAGCCAACAGGT
Long Flanking Sequence:
AGGAGAAGATTGACTTAAAGAAGACTGTTGTGAAGACCCTGGAAGAATACACCAATGACAGCTCCACCCCTGCTGAGGATGAAATTGTAATGATACAAGTGCCCCGTTCTAAGTGGGAAAAGGAGGACTATGAATCTGAGGATGATGATTCTAAGGTTCTCAACAGGACGAGCAGTGCCGATACATCTGTCGCTGCTCCTTCAGTGGAGAACTCTGCTGTGAAATTATCTGACAAGGAGTCTCCCCATTCTGACAAAGCCCAATCTACCTTGAAAGAGGCTGATGTCAAACCTGCCAAAGACTCCACCTCAGGTGATAAGGAGAAAGATACTGACAAAGACAGAGAACGAGAAAGAACCAAAGAAAAAGATCGCAGCAGCACTACAGATCGTGAGTCAACTGATAAAAAGAAACCTAGTGTACCTAATCAGGAGAGCGCACATGCACAGGAGAAAGGCAGTGACCATGGCAGTGAGCGGAGCTCCTCTTCTCAGTCTTCT[A/T]GAGACAGGCAGGCTGATAAAGCTGAACCAAACTCTAGAAAGCCAACAGGTAGGGAGACGACTACAGGCCCCACCAGTAGGAAACCAGAGCATAGAGATGATACAAAAGACCACTTGGGTACAAGATCAAAAGATGAGAAAAATCCAATCAGGAGAATACCATCATCCCCACCATCAAGGGTGAAGGACTTGCACAAAGACTCTGGGAGAAAAAATCTTGAAGCACCTCAAGAGTCACAAAGTCCAAGTAGGACTAAGAGAGCACCAATTCAAAATACCTCTGAGCCAAAACGATCAGGTCCAGAGGACCACAGAGAGAGCCAGTCTTCTAGGCATTCTGAAGTGCGTCCCAGTAAAGACAAAGAGCACAGGACTCCACATATAACTTTGACTCCTGAGCCAAGGACTGATGCGGAGAAAAGTGCTCCACATGTAGACCATATCAAAATACCGTCTGCGCGCTTGACAAGACTCTCCTCAGATTTAGCACGGGAAACCGAT
Associated Phenotype:
Not determined