Busch Lab

ZMP

itga3a

Ensembl ID:
ENSDARG00000037917
ZFIN ID:
ZDB-GENE-090805-3
Description:
LOC407685 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW79]
Human Orthologues:
ITGA6, ITGA7
Human Descriptions:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
integrin, alpha 7 [Source:HGNC Symbol;Acc:6143]
Mouse Orthologues:
Itga6, Itga7
Mouse Descriptions:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]
integrin alpha 7 Gene [Source:MGI Symbol;Acc:MGI:102700]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa26106 Nonsense Mutation detected in F1 DNA Not yet available
sa9528 Nonsense Available for shipment Available now
sa33228 Nonsense Mutation detected in F1 DNA Not yet available
sa20069 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26106
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Nonsense 87 1053 2 26
Genomic Location (Zv9):
Chromosome 3 (position 34959959)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34745155
GRCz11 3 34874663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGCGGAGTCTGGACTGTCAGCCAATGAGACGGGAGATGTTTACGCCTG[T/A]CCGATCTCTGCAGACTCCAAAGACTGTGCAAGACTGAACCTCATCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9528
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Nonsense 492 1053 11 26
Genomic Location (Zv9):
Chromosome 3 (position 34972545)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34757741
GRCz11 3 34887249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAAATCAGTACATTTTGTTTTCTCAAACAGCATTGAAGCAAAAGTCTG[T/A]TTCTCCTACACATACAGCACTGGCACTGCCAGTTCCCAGAAGGCCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33228
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Nonsense 533 1053 12 26
Genomic Location (Zv9):
Chromosome 3 (position 34972820)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34758016
GRCz11 3 34887524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGATCAGCAGTCGTCTAGGAGCCCCCGTGTTAGTTTCCTTGACAACAAT[A/T]AGGGCAAATACACTGGCAAAATGTCTGTTAATCCGTCTGGAGATTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20069
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055263 Essential Splice Site 751 1053 17 26
Genomic Location (Zv9):
Chromosome 3 (position 34979211)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34764407
GRCz11 3 34893915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATTTCAATAGACATGCAGGAGATTGAGACAGAGCTGCAGCTCTCAACG[T/A]ATGAGAAATCACCCTGATTTACTTCAGATTCTCAAATAAGCTGCACATTT
Associated Phenotype:
Not determined