Busch Lab

ZMP

cacna1aa

Ensembl ID:
ENSDARG00000037905
ZFIN ID:
ZDB-GENE-040724-26
Description:
Novel protein similar to vertebrate voltage-dependent calcium channel, P/Q type, alpha 1A subunit (C
Human Orthologue:
CACNA1A
Human Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Source:HGNC Symbol;Acc:1388]
Mouse Orthologue:
Cacna1a
Mouse Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit Gene [Source:MGI Symbol;Acc:MGI:10948

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11918 Essential Splice Site Available for shipment Available now
sa20062 Essential Splice Site Available for shipment Available now
sa8529 Nonsense Mutation detected in F1 DNA Not yet available
sa20061 Essential Splice Site Available for shipment Available now
sa33223 Nonsense Mutation detected in F1 DNA Not yet available
sa25253 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11918
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 127 1863 None 41
ENSDART00000138765 Essential Splice Site 126 1939 None 43
ENSDART00000144774 Essential Splice Site 126 1938 None 43
Genomic Location (Zv9):
Chromosome 3 (position 33966129)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33751325
GRCz11 3 33880833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAACAGCACCTTCCAGACGGGGACAAGACACCTATGTCAGAGCGTTTGG[T/C]AAGTTCAGGTCTTGTTGATCAATGTTACTTTGTTTCTAGAAGCTACATAC
Long Flanking Sequence:
CATCTTGTACAAACAAAACTGGAAAGTTAGGCAGCCAGTTAAATGGGTATTGTCTGAATATGTATAATATAATGTATAAATGTGTTCTTTTAAATTGAGTGTGTTATGTAATTTAAGTTTTTGCTTATGCCTTTCGGAATGTATGTATGAAAAATTTTAAAACTAAGTAGGACAAAACAGTACTGCATTTGGGAAAATGTAGATTATTCTGTCATTTTAATCTCCACTGTACTAAATGTAAATATCGTATAGCTTTGTTCAGGAACTGGAGGCAAAAAATCTTCCTTAACATTTCTTCAAGGGAATGCAAAATTGAACAGCTGTCTGTGTATTACAGACATTTCTAAATCTGTTGTAGCGTTCATGTTAAATTCCTTGACCTATGATTCTCACTCCATTTGAGTACATGATCCTGGCAACCATCATCGCTAACTGCATTGTCCTGGCCCTGGAACAGCACCTTCCAGACGGGGACAAGACACCTATGTCAGAGCGTTTGG[T/C]AAGTTCAGGTCTTGTTGATCAATGTTACTTTGTTTCTAGAAGCTACATACTGTAACTCAACATAAATCCCAGAATATAATTGGTCTCTGTGTGATTCTTTTTTGAAGAAATGGTAAACTCACTCTTGTTTCCCCATGTCCATTTGTTTGTCTTTCTCTCTCACAGGAGGACACAGAACCCTACTTCATTGGCATTTTCTGTTTCGAGTCAGGCATTAAGATATTAGCTCTGGGATTTGCCTTTCACAAGGGCTCCTACCTACGAAATGGCTGGAATGTGATGGACTTTGTAGTGGTGCTTACTGGGTAAGTCTGAACAAAATCTGCATGCTTAAAGCGATCACTAAGAATAAATTGTGTATTGTTTATATGCCCATCCTGCCCATTTAGTTTTAACAGTCATTCTCTAGAACAGGGATGGGCAAACTTGATCCTCGAGGGCCAGTGTCCCTGCAGAGTTTTGTTCCAACACTAGTCAAACACACCTGAACAAACTAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20062
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 205 1863 4 41
ENSDART00000138765 Essential Splice Site 204 1939 4 43
ENSDART00000144774 Essential Splice Site 204 1938 4 43
Genomic Location (Zv9):
Chromosome 3 (position 33942287)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33727483
GRCz11 3 33856991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGCTGTTCGAGTGTTGAGACCTCTCAAGCTGGTGTCTGGGATTCCCAG[T/C]AAGTGGCATATTTCTGCATTTGCTCATTCACATGCTGATGTGGTCCGTTT
Long Flanking Sequence:
AAACAGAATAAGTCATTAATGTAGCATACAGAGGAACTTTAAAAAATCTCAATCTGGTTTCTTGCATGTGACAATGAAACATTTGGGATGTGCTGGATAAGGAGATTCAAATTTGCAGCAACTGTGATGATATCATGACAACAAAATGGTTTAATTTAATGAGTTAGAATTTAATTTTTTTCAGTGTTCAGAATTTACATTAGTTTAGTCTGGATGTAAACTGATTTACATGAGCCCTCATCACACACTATTGTCATTGTAATCATTTTTTTTTTCAGCTCAGAATGAAAAATGTCACTAAATGCAAGTTCTCTGTCATTACAAAGGCTGTTGTTTATCACATTATCCTGGATTAAACCTGCACTGTCTTCATATTTTTTAAACTTTCATTCTATATATCTGTCCAGAATCCTGTCCACCGTGGGCTCAGACTTTGACCTGAGAACTCTACGTGCTGTTCGAGTGTTGAGACCTCTCAAGCTGGTGTCTGGGATTCCCAG[T/C]AAGTGGCATATTTCTGCATTTGCTCATTCACATGCTGATGTGGTCCGTTTCTTGTAACCTTAAAGTGGTTATTTTGCCATCATTGGATGCTTTTGAAAACAGAATGTATTGATTACATTTTGTTGCATGATTTAGGCCCAATCACAATTCTACCTCTTAGCCCTTCCCCTTGTCCCAATTCTCTTTAGCTTGAAGGCGTAGGGCTAAGAGGAAAGGGGTAGATACCCCTTCAAACAGAGATTTTTTTAGGACTACACTCAAAACCAAGGGGTAAGAAACTTTCCCAGAACACACCAGCCACAACGGCAACATAGCAGTGCCTGGAGATCCACAAATTAATATTTTTTGTCATTATTCAGAATTTTTTTTTACAACAAACAAGCACATGTTTTAAAACATTCATAACCGCTTTTGTGTTTTATCGTCATGCTTTTTTAAAGAAAACGCTAAAATAAAAAAACAATAATTTTCCCTATCTATAATCCCTAATAATAACTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8131
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 412 1863 9 41
ENSDART00000138765 Essential Splice Site 410 1939 9 43
ENSDART00000144774 Essential Splice Site 410 1938 9 43
Genomic Location (Zv9):
Chromosome 3 (position 33934134)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33719330
GRCz11 3 33848838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCTGGCTGACGAGGACAATGACCCAGATGACCGAATGCCCTTTGATGG[T/A]ATTTACATGAACTCTTCCATCCTTCCTTCCTTTTCATCCCCCTCTTCTCC
Long Flanking Sequence:
GACCAAAAAGGATTTGTCTTAATTATCTAGTGTGTATGCTTTTCAGGCAATCGTCTGTAGTTGAGCATTAATTTTATTGCATGTGTGCAATACAGAGAGTTTGCCAAAGAAAGGGAGCGTGTGGAGAACAGGAGCGAGTTCCTAAAGCTGAAGCGTCAGCAGCAGATAGAGAGAGAGCTGAACGGATATCTGGAGTGGATCTGCAAAGCAGGTAAATGCCATAGAAAGAGCCATTAAATACTCCGGAGAGCAGCTGAAGCCAAGAATACAGATAGTAGCCTGTCTCATTTGATACGGATGTCTTTACACATGTACGTCTCAGTCTTGGAACATGCTGATAATGTAGGAATTGTTGCAAAAGGCATTTTTAAGCACAAGCAATTATCCCCAGGTTCATAATTTTTGCAGTGGTTTGATTCGAATTTTGTTTGATTGTGTGTAGAAGAAGTGATTCTGGCTGACGAGGACAATGACCCAGATGACCGAATGCCCTTTGATGG[T/A]ATTTACATGAACTCTTCCATCCTTCCTTCCTTTTCATCCCCCTCTTCTCCTCTCTTTGGTCCCTCATTGGGACTAGGTGTTGATTTCCCATTGTAAAGGAAGAGAGATATCAATAGCATGTTGGCTTTGCTGAAGGAGTGATATTGTATACTTCATGTCTATAAGTGCAGTTAATGTTGTTCATGAGCAGTACATGTATGTACATAGACCATTCATCTGTAGCTTACATCCAAATGTCAGATTTTTCTATATGATCCGTATAGTAAACATGCTACACTTCCAAAAAGTCTCATATTTTCTATCAATGTGCTTATGTATTTTCTATCTACCATATTTTTGAAGAAAGTAATGTTTTAATGTATAAATCAGATGATATAATATAATTTATAACTAATGCAAAATAACAGTAAATAAAAATAAATGTTTAATCCACTTCAAATAATCCATTGAAGTTTTTTTTTAACTTTCAGTTTAGTATTGAAAAGGGAATACAAAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8529
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Nonsense 1129 1863 23 41
ENSDART00000138765 Nonsense 1119 1939 23 43
ENSDART00000144774 Nonsense 1119 1938 23 43
Genomic Location (Zv9):
Chromosome 3 (position 33920998)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33706194
GRCz11 3 33835702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGCATGTTCTATGATCTTGTGTTTTAGATTTCGGAGATTGTGTCACTA[T/A]ATCGTCACACTGAGATATTTTGAGATGTGTATTCTACTGGTTATTGCTAT
Long Flanking Sequence:
TTATTAATACGTGTTAGCATTGTGAGCTAACAATGTTATTTTCACAAATGTTATTAAAAAGTTGCAATAACAAACATAACTCTAAAGTAAATGTTTTAGATATATCTAAAAATAATTGTGTTGAAGCACCAGTCGCTATTACATGTTACTTTATGCTGCCATCTGATTCTAATAGCGGTTAGTTAACACTATGAATGATATTATAATGTTAGCAGAAAATTGGACTTTAGGAAAAATAAAACAACACTCCGACTTCTTGGCTCTAATCTAATGTATGTAATGACTATCATGCTTCACCTGAAAATGTCTACAAATATGGAAAATCTGTGTAAAATGGGTTGGAAACACTGTTGACTTTGATTTAAAAAAAATTGATTAGACTCCAGGTTTCACGTGATTAATGAGCTTTTTAATATTCTTCTTCGAGTTGATGTGTAAATGTGTTGTTAACAGGCATGTTCTATGATCTTGTGTTTTAGATTTCGGAGATTGTGTCACTA[T/A]ATCGTCACACTGAGATATTTTGAGATGTGTATTCTACTGGTTATTGCTATGAGCAGTATTGCCCTGGCTGCTGAAGACCCTGTCTGGCCTGAATCTCCCCGCAACAATGTGAGAAAATCCAACAGCTCAACATCCACTGCTTTTGTTCCTGCCATCCCATCAACTCCCAATCTATGCTTCCAGTCCATAACATCCGTCTATATTTTCATCCCTCCATCCTTTCATTTATCATTCATTATATCCATCTTTGCATTAGTGGCAGGAATAATTTCATTTCATTTTTTTGCTGACATTTTGTCCCTCTTTTGTGATTACAGGTCCTACGATACTTTGACTATGTGTTCACTGGTGTGTTCACCTTTGAGATGCTCATTAAGGTACACATTTGGCCTACATAGTGGTCTGGAGATTTAACACCTTATTTTTTCTTTATTTGAAGATCTAAGTATTGGTCTCGATGTGATGATGTGTAGCGTTAGAGCATATATTTACTTATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Essential Splice Site 1422 1863 29 41
ENSDART00000138765 Essential Splice Site 1412 1939 29 43
ENSDART00000144774 Essential Splice Site 1412 1938 29 43
Genomic Location (Zv9):
Chromosome 3 (position 33904199)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33689395
GRCz11 3 33818903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCAAGGAGACAAAATGATGGAGGACTATAGCCTGGAAAAGAATGAGG[T/C]GAAGGACATATCAGATGCATGTGTTTATAAGCTTAAGACCAATCTCCTTT
Long Flanking Sequence:
ATATAAATACATACACAGAAGTGACAGAAGTATAACTATGAAATGTGTATATATATATAAATATCTATGAATGTAAACAATATATAATACTGACTGTGGAGTAATGTAAACAGTGTATAGTAGTCTGTTATCTGGTGACGCCAGATAAAGCAAGGACTTAGCCAAAGGAAAGTGAGTGAGTAGTCCTAAAAAGTCTTAAGTTTGACTTGGATGAGCCTGCAGAAACCCTTTAAAAGGGTGTACAGAATCACATCACATCCAATTCCCCAATGTCTGTTATTTTTTGCCACTTTTCAGAGTGCTAAAACATTCAGTAGATGCGACCTACGAGAATCAGGGCCCGAGCCCAGGTTACCGGATGGAAATGTCCATCTTTTACGTGGTGTACTTCGTGGTCTTCCCCTTCTTCTTCGTCAACATCTTCGTGGCTCTTATCATCATTACTTTCCAGGAGCAAGGAGACAAAATGATGGAGGACTATAGCCTGGAAAAGAATGAGG[T/C]GAAGGACATATCAGATGCATGTGTTTATAAGCTTAAGACCAATCTCCTTTATTCTCAATGCTTAGATTGATCTCATTTGTATGGTATGGCAGATTTTCAGCTTGATTAAACTGCATTGCCTCTGTTCTGTTTTCAGAGAGCCTGCATAGACTTTGCCATCAACGCTAAGCCGCTCACACGGCACATGCCCCAGAACAAGCAGACCTTTCAGTACCGCATGTGGGAGTTTGTGGTGTCTCCTCCATTTGAATACACCATCATGGCCTTGATCGCGCTCAACACTATTGTCCTTATGATGAAGGTGAAAACGAGCACTGACTAACACCAGCAAATACACAATAGGGTCTTGCATCGATCCTAAAAAACCAAACTAATATCCTGTTTACACTTGTTTTGTTTTTTTTGGATCACAAGTTGCCAAGAAGGACACATTCTTGTTCACTCCTGTGATTAAAAACAAAGCAAAAATTCCCTGAAGAAATGCAGCAGTTCACATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33223
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Nonsense 1683 1863 36 41
ENSDART00000138765 Nonsense 1673 1939 36 43
ENSDART00000144774 Nonsense 1673 1938 36 43
Genomic Location (Zv9):
Chromosome 3 (position 33893608)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33678804
GRCz11 3 33808312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGGAGCGAGTTTGCCTACCTCTACTTTGTCTCCTTCATCTTCCTCTG[T/A]TCATTTCTGGTGAGTACAAGAGCTCTGCCATAATGGACATGGGCGCCATT
Long Flanking Sequence:
TCAGGCTCTGCCGTATGTGTGCCTACTCATCGCCATGCTGTTCTTCATCTACGCCATCATTGGCATGCAGGTGGGTGTGTGTGAGACAGAGTGTGGAATGCACAACTGGACTCACTGAGAATAGCCAAACAACTATTTTTTAAGGTTAGTGACCTATGCAATATGTTTTTGATTCTCACAGCTGTTTGGGAACATTAAGATCGAGGAGAACAGTGACAGTGCCATTACCCAGCACAACAACTTCAGGACTTTTTTCCAGGCCCTAATGCTGCTCTTTAGGTTTGTGTGTGCATCACATACTGACTACTGTGTGTGGACCATGTATTCTTTCTAACCATAGTTGACCTCTGTGTTTGCAGGAGTGCTACAGGTGAGGCATGGCATGACATCATGCTGTCATGTCTGGGAAAGAAGCCGTGTGATATTCTCTCTGATAACCCGAAGCCAGAATGCGGGAGCGAGTTTGCCTACCTCTACTTTGTCTCCTTCATCTTCCTCTG[T/A]TCATTTCTGGTGAGTACAAGAGCTCTGCCATAATGGACATGGGCGCCATTTTTTGTCACCACAGCTTGTTGCTATGGCTAATTTTGCTCCTGCTAATAGAAAATGAAATGATTTACATTTTGTTGAGCAGAAGTTTTCATTTCATTAGTGGGTATTATAATATAATGATAGCGGGCCTTGCTCTGTAATTTATTATTTTAATGGTTGCTCCATTTGTCATTCATGATGAATAGCGACTCTGATAATGTGGCATGTTTTGCAAATCTCCAACCAAATTGAAAAGTTATGTGTTTCCTTTAAGCTGAGCTCACACTACAGGAGGTTCATCCTAAAAGGTTTTTTAATTTGATTGCATCATGCCCATAAGGAGAATCTTTTCTTCTCTCAGATCTCAAACACGCACACACTACAAGATCTACAAAAGCGTAGCACATCACATGCTTCAATATATTATGATGCTAGGGAGAGCAATACACATGGTTTGACTTAACAGATTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25253
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013228 Nonsense 1763 1863 38 41
ENSDART00000138765 Nonsense 1750 1939 38 43
ENSDART00000144774 Nonsense 1750 1938 38 43
Genomic Location (Zv9):
Chromosome 3 (position 33889389)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33674585
GRCz11 3 33804093
KASP Assay ID:
554-7754.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCTCCTCCGTTAGGCCTGGGGAAGAAGTGCCCTGCACGGGTTGCCTA[C/A]AAGGTATAGGGCCTCCGAGCGGCCAGCGCTGTGTCTGTACTGTTGGTGTT
Long Flanking Sequence:
GTGCATTGTTCTGGGTGGAGGGGGACAGAAACTGCATTGACACAAAACTTCATTACAACGCCCTGCCAGCAGCGGGACTTTGTGCCTGTTCTGAAGCCCCCCTGCTCTTCTATGCAACTTGCCCCTTTGCATAGAATGCCGTTTTAGCACTCAGACGTTGAGCACCCCCTCCCACTTCCCCCTCCCGTTACCCACAAATAAATCAATCAATCATCAGGCTTATGGCAGCCTAGTTTACCAAACCACTCCTTTCGTCCAGGCCAATAACCTTCTTTTTGTTGTGTTCTCCTCCCCTCCCTCATCCCTGACCCGAACCCTTCTTTTTGATTTACTCCTTTTCTTCTTCTCTTTCTCTCTCTTTCCCATGCACATTTCCTTTGGTTTTTTGTTTTGTTTCGGTTGCCCAGTGGCAGAATCAGTTACAGGGATATGTATGAGATGCTCAGGCACATGTCTCCTCCGTTAGGCCTGGGGAAGAAGTGCCCTGCACGGGTTGCCTA[C/A]AAGGTATAGGGCCTCCGAGCGGCCAGCGCTGTGTCTGTACTGTTGGTGTTTTCTCTTTTTTATTTTCTCTCCTTCTTTTCCTCCTTCGTTGTCTGACGGAGGCCGCTATTGTGATTCTGGTGGCAGGGTCGGGATCGAGGGTTTTACACTCAGGCGGGACTATCCACAGGGAAGCGGGAACGGACAAACCTTCTAAGCACTTTTGCACCGTATGAACACACAAACACTAGCACACATGTACAGAGGATGACATGTAAATGTCTCAGATTTGTTGTTACAAACTATATTGTTATCGATACATTAAAGCAAAAAGCTCAAGCTTTAATGTTCACCTAATGTTCACAATGTACAGATCTGAGATACAGTAAGGTAATAAGCACAAATGTTGTGTCCCAGATGATGCATTATACAATTATGCACTTATACTATGTACTCTACTAGTTCTGTTTTGTTTTTGACATCCATCATCAGAGGAAATCTACAATAGTTGAGTCTGTAAA
Associated Phenotype:
Not determined