Busch Lab

ZMP

CACNA1C

Ensembl ID:
ENSDARG00000037904
Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit [Source:HGNC Symbol;Acc:1390]
Human Orthologue:
CACNA1C
Human Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit [Source:HGNC Symbol;Acc:1390]
Mouse Orthologue:
Cacna1c
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit Gene [Source:MGI Symbol;Acc:MGI:103013]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa30643 Nonsense Mutation detected in F1 DNA Not yet available
sa31689 Nonsense Available for shipment Available now
sa41314 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7164
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Essential Splice Site 162 839 5 21
Genomic Location (Zv9):
Chromosome 8 (position 55576513)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53472169
GRCz11 8 53453523
KASP Assay ID:
554-4588.1 (used for ordering genotyping assays)
KASP Sequence:
CGCAATAATAATTTCCAGACCTTTCCTCAAGCCGTGCTCCTGCTGTTCAG[G/A]TGYGTTCASGACAATATCGTAATAATCAGTCAGTTTTGATTSAGTGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30643
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Nonsense 470 839 16 21
Genomic Location (Zv9):
Chromosome 8 (position 55571455)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53477227
GRCz11 8 53458581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATCAGTTCAGCAGTGTTACCCAGCGTCCTCTGCAGCTGCCGCTCCCA[C/T]AGAGTCAGCCACTGTCCGATGCCAGATCCTCCAACTCCAATATAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Nonsense 601 839 18 21
Genomic Location (Zv9):
Chromosome 8 (position 55569095)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53479587
GRCz11 8 53460941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCCGAGACCAGGACATGTATGAGAGTGTGTGTGATGATGAAGACGAG[C/T]AGCTGATTTCCCCGCATCCCCAGCGCTCCTCAAGACGACTCCTGCGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41314
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065375 Nonsense 824 839 21 21
Genomic Location (Zv9):
Chromosome 8 (position 55565302)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53483078
GRCz11 8 53464432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTCCAAATCTACGAGATTACAGCGATGAGGAGACGGACAGTAGCAGC[C/T]GACGGGACGAGGATCTGGCCGACGAAATGATCTACGTCTCAGTGTTGTAG
Associated Phenotype:
Not determined