Busch Lab

ZMP

nde1

Ensembl ID:
ENSDARG00000037900
ZFIN ID:
ZDB-GENE-050913-61
Description:
nuclear distribution protein nudE homolog 1 [Source:RefSeq peptide;Acc:NP_001025374]
Human Orthologue:
NDE1
Human Description:
nudE nuclear distribution gene E homolog 1 (A. nidulans) [Source:HGNC Symbol;Acc:17619]
Mouse Orthologue:
Nde1
Mouse Description:
nuclear distribution gene E homolog 1 (A nidulans) Gene [Source:MGI Symbol;Acc:MGI:1914453]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16091
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055242 Nonsense 117 336 4 9
Genomic Location (Zv9):
Chromosome 3 (position 36510808)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36538296
GRCz11 3 36680154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGGCAGAGACCACAGCCATCAAGGACCAACTGCACAAGTATATCCGA[G/T]AGTTGGAGCAGTCCAATGAKGAYCTGGAAAGAGCTAAGAGGTGGKTTYAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26114
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055242 Essential Splice Site 321 336 8 9
Genomic Location (Zv9):
Chromosome 3 (position 36508287)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36540817
GRCz11 3 36682675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAACACCAGAAATCCCATCCAACACAAATGGCTTGTATGATAAGGGG[T/G]TAGTCTTGACGTTAATTCCAGCACATGTCTATTATTTTTCTATTATAACA
Associated Phenotype:
Not determined