Busch Lab

ZMP

wipi2

Ensembl ID:
ENSDARG00000037871
ZFIN ID:
ZDB-GENE-040718-488
Description:
WD repeat domain, phosphoinositide interacting 2 [Source:RefSeq peptide;Acc:NP_001002729]
Human Orthologue:
WIPI2
Human Description:
WD repeat domain, phosphoinositide interacting 2 [Source:HGNC Symbol;Acc:32225]
Mouse Orthologue:
Wipi2
Mouse Description:
WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI Symbol;Acc:MGI:1923831]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa33274 Nonsense Mutation detected in F1 DNA Not yet available
sa40136 Nonsense Mutation detected in F1 DNA Not yet available
sa16973 Nonsense Available for shipment Available now
sa12209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33274
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102429 None None 131 None 7
ENSDART00000128655 Nonsense 95 431 3 12
ENSDART00000134026 Nonsense 95 425 3 12
ENSDART00000143135 Nonsense 67 310 2 9
Genomic Location (Zv9):
Chromosome 3 (position 40828542)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40691902
GRCz11 3 40833760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAACTGAAGGTCTGTCATTTCAAGAAAGGGACGGAGATATGCAACTA[C/A]AGCTACTCGAACACTATACTGGCTGTGAAACTAAACAGACAGGTGAGTCA
Long Flanking Sequence:
CAGACTTCACCTGTAAATATAATATTAATAATCTAGTATTAAAATCTAGTCTAAAATGTCTAAATCATCCATCCACCCAATTGTTTTAATGAAGAATTTTGAAATCAGTAAATGAATCTGAATGAATGTTAATGTAGGAAAATCAGTATATTAAAATATCACACTTTAAAATGTTAAAAATGAAGCATAAAAATACTTGAAATCACAAAACAAAATGTGCATAAAATAGTTCAAAACCAGTTTTGATCTCTTTTGCTCAATGTTGAGTCTTTGAGTCCAGAAGGTTGAGTGCTGCTCTAGTCCATTATAAATGCTTGCTTTATTCTCCTACACAAGGCATGTTTTATGTACTGTCATTTATTTTAACTCACAGCTGACACAGAAGATGTGTGCATCGTGGAGAGATTGTTCTCCAGCAGCCTCGTCGCTATCGTCAGCCTTAAGGCTCCAAGGAAACTGAAGGTCTGTCATTTCAAGAAAGGGACGGAGATATGCAACTA[C/A]AGCTACTCGAACACTATACTGGCTGTGAAACTAAACAGACAGGTGAGTCAGCAGACATCCTCTTCTTCTCACAACACTTACCATATGAGTTTATTTTATTAAGTGTGATCGAACTGTCTGAGAATGTGCTTTATTTCCACAGCGATTGATAGTGTGTTTAGAGGAGTCACTCTATATCCACAACATTAGGGATATGAAAGTACTACATACCATTCGAGAGACCCCTCCCAATCCTTCCGGTGAGTAACACTGCTTGCCATAAGTACATTATTGTTGTTTTTCTTCCAGATTTTTCTTGAGGAACTACAGTACATCAGCTTCCTCTTTCAGAACGCCGTGCTCTATTTATATTCTGAGAACTGAAAGAATAGGTTTGGAAATTATGTGGTGACCAGTTAGCATTGACCTTGTTGTCATTGGGCTTTTGGTGCAACTAAATCCTACAGATGGTGGCAGCAGCAATGGGTTTAAGAGTGCTGCACAAGTAATATAAGGCACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26133
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102429 None None 131 None 7
ENSDART00000128655 Nonsense 167 431 5 12
ENSDART00000134026 Nonsense 167 425 5 12
ENSDART00000143135 Nonsense 139 310 4 9
Genomic Location (Zv9):
Chromosome 3 (position 40823564)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40686924
GRCz11 3 40828782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACAACTGCTACCTGGCGTATCCGGGAAGTGCAACGATTGGAGAAGTA[C/T]AAGTTTTTGACACAGTCAACCTGGTAAGTAGTGTTTAGCTGAAATGTTTG
Long Flanking Sequence:
CATTGTTCAGGATAATGTTCTTACAAACTGTCAAAAACTATATGCTTGTTACCATATTTTACAACACATGGAAATAATTGCAGCTTTTTAAATTTAAAAACGATTAATCGTGCAGGCCTGCATAAAATTCAGTACAAATATGCAGTATGGCATTTCTGCCAGTTGTTTCCCATGTTAGTGCGTTGAGGAGAATAACAACTCCGTTTCGCGATGATATGGAGAACTAGTCTGTTAAAACAACTAGTCTTGTTACACTTCTAGTGTTTTCAGCGATGTATCTCATACACACAAAATGTCATCACACCAGTTTAATTTAGTCAGAAAAAAGTTTACAAAATGGGACCACATATTCACAGCCCTATGTCATAACTCCAAGTAATCCGATGGTGTATGTTTGTTTATTAATATGCCGCTAAATATTTACAGGACTTTGTGCCCTGTCAATCAGTAATGACAACTGCTACCTGGCGTATCCGGGAAGTGCAACGATTGGAGAAGTA[C/T]AAGTTTTTGACACAGTCAACCTGGTAAGTAGTGTTTAGCTGAAATGTTTGCCGTAATTATGGTTTTTGCAAAATGTTGAACAGTGTTGATCAATGTGTAATAATTATTTCCTCTCTGCAGAGGGCAGCTAACATGATACCTGCCCATGACAGCCCGCTAGCAGCTCTGGCGTTTGATGCAAGTGGCACTAAATTGGCCACGGCTTCTGAAAAGGTTTGAGAAGCTGTCTTTGTGTGAGGTTTAAGCGAACTAATTTAGTGGTTAAATTTCAGACTCTAAACTGTTTTGCTGTCAGTCTTAGATGAAAAAAATGAAAATGTGTAAAAATATTGCAGTGTATTACTTGTTTTTTTTTTTTTTTTTTGTAATGTTTATTCAGGCCTGGCGCTACGGGAGGGCAAATGGGGGCATTTTCCCCTCAGAAAGAATTTGCCCCCCCCCCTTTTTTTTTTTCATAAAGGATTGCTTCAGAACACACATTTAGATACTTTATATTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40136
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102429 Nonsense 17 131 4 7
ENSDART00000128655 Nonsense 311 431 9 12
ENSDART00000134026 Nonsense 311 425 9 12
ENSDART00000143135 Nonsense 285 310 8 9
Genomic Location (Zv9):
Chromosome 3 (position 40820880)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40684240
GRCz11 3 40826098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGTTCACTCAAGGACGGGCGTTTGCCACAGTCAGACTGCCTTTTTCA[G/T]GACACAAGAACATCTGCGCTCTGGCCATGTGAGGAAACATTTTTGAAATA
Long Flanking Sequence:
TTTAAATAGTCAAGATTTATAAGCACACCCAGTGAAAACAATGCACTTTCTTTAATTATCCCTTAACAGATGTGTGAGCATCTGTTCCCTGGCCTTCAGTATGGAGGGACTCTATCTGTCTGCCTCGAGCAACACAGAGACGGTTCATATTTTTAAGCTGGAGACCCAGAGAGAGAAGTCAGTGTAATGTTGCCCACTGAACAGAAGTGGTTTTTACTCTTTCTCAAATTACAAACACAACATTTTTTAATGATTTTCCTTTTCATTAATTGATTGATTATTTTCGTGACAATATAGCCGTAAGTTGCATTAAAACAAATCAGAACAATACTGTCCTTTTCAAACTCCTGGTTTTCCACCGTAGGCCTCAGGAGGAGCCCACTACTTGGACGGGATACTTTGGGAAAGTGTTGATGGCCTCCACAACATATCTGCCTGCACACGTAACGGAGATGTTCACTCAAGGACGGGCGTTTGCCACAGTCAGACTGCCTTTTTCA[G/T]GACACAAGAACATCTGCGCTCTGGCCATGTGAGGAAACATTTTTGAAATAGCACACCGCTGGTTTATATAATCCACATTCAGACTGTAGTTGCTATCAGGGTAGATGTGTGTCTGATTATCTTGCTTGTGATCGGTATCTAGAATTCAGAAGATTCCACGGCTGCTGGTGGCGGCTGCAGATGGCTATCTGTACCTGTACAATCTGGACCCTCAGGAGGGAGGAGAATGCACACTAATGAAACAACATAAGTGAGATACAGTGCACTGTTTAATATTTACAGCAACATTTTATCAGCAAGTTCTTAATGTTTTTAAAGAAAGTCTTTAATTCTAACCAAGGCGCTGCATTTGTTAAATTAAAAATGTCATTAAAACACAAATACTGACAAAATCCTTTTTTAATTTAGAAATTTATAAACCGTGTGATACAAAGCTGAGTTTTAGCAGCATTTACTCCAGTTCTCAGTTGTAGGAAGTTTTCATAGTTCTTATAACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16973
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102429 Nonsense 76 131 6 7
ENSDART00000128655 Nonsense 370 431 11 12
ENSDART00000134026 Nonsense 370 425 11 12
ENSDART00000143135 None None 310 None 9
Genomic Location (Zv9):
Chromosome 3 (position 40819026)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40682386
GRCz11 3 40824244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YGTCCTTCAGGTTGGATGGAAGTGCAGAGCCTGCGAAWGAAATTCTTGAA[C/T]AGACAGCTCACGATCGGCCACYTGTGGCCCAGACCTACAGTGCTGCTGTT
Long Flanking Sequence:
AATAAAGCAACCTGAACTTGAATGAGAGATAGAGAGAAGCAGGTTTGATCTGTCAGTGGGTGCACATGGCTCCTGAATAACATAAAAGAGAAATAGTAGATATTTTATTTATTTCAACTGTCTTTTTTTACTTTAACCAATTGGAAAAAAAAAGTTTAAAACAGATAATAATAAAAAAATAGTGTTAAAAATCTTATTATGTTTTGTTTGTCGCAAATAGTTAACTATTTATGTGCCATGGGAAAAAGTGTGCTTCGATCCGGCCACCACCGCAAGTATATTTCAAACCTGTGGGAAGCACTGTATAATATATGGATTAATATATTACCTGCGTATTTATTTCAAGAATTGGGTTAAAGTTGGCCTAAAATCATAGGAAAATAAGTCTTAGTTTGGCCCTGTATTGGCACTGAATGACATCATAGGTGATTTACTCATGTAAACATGTATCGTCCTTCAGGTTGGATGGAAGTGCAGAGCCTGCGAATGAAATTCTTGAA[C/T]AGACAGCTCACGATCGGCCACTTGTGGCCCAGACCTACAGTGCTGCTGTTGCCAAAGGTAAGAAAAAAAAACTGGTTCCTTTTTAAGTGAAGTTTTACAAACTAATTTCGAGAGGATTATGAGTCATGATTGACCACAGCGGGCCTCACATCAACAATCAAATGATAGACCAATCAGATGAATTCAAGCCTATGTAAATAGCCCATATTTCTTAGAATCCCCCCAGAATCCACTCATCTCCCCTTCGTTCCATACTACACCAGGGGAGCTCTTGAGACCAACCTGATCTTAGACTCCCTACTATACTAAGGTTGTACTCGCACTATGCTATCCAAACCATGCCAAGGTGCATTTCCCAGCTCATTTGACATGTGTGAATGCTCCGAATCAGGCCCAGGCGCAGTTCAGTTGGCCAGACCTGGCTCGGTTGGAAGAAGTGTGCCAGAGCACGGTTCGGTTGGGCTTTGGTGCGTTACACTTGTATTGTGAGTGCAAAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12209
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102429 None None 131 None 7
ENSDART00000128655 Nonsense 390 431 12 12
ENSDART00000134026 None None 425 None 12
ENSDART00000143135 None None 310 None 9
Genomic Location (Zv9):
Chromosome 3 (position 40816993)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40680353
GRCz11 3 40822211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTCTTGAAACTAAACTAGAGTTAAAGAAGAAACGTAATAMTTTTAATA[T/A]GCTGTAATCRCAGGTTACAGTGAGGATCAGGGGGCTGTAGGGGGAGCTGG
Long Flanking Sequence:
TGTTCAACTTGTCAAAAATATTAGTAAAGCAAACACAGGCCCTATATGTGTCATTTACATATATTTCAATTAGTATGGAAGGCCAGTGCATCTTTTTACCAAATCTTTTAATTTTATTTTAAATGCGTGTGCGTGTAAAACAATATAATTTGGACAAAGAAATGATGCGGTTCATCTCTAAAGAAGTTGTACGTTTAGAGCATTATTATGGGCGTTTTACGTTATAACTAACGTGGTTTAAGCGATGGATCTGCGATGGTTTTGGGAAACACTCGTCACTACATTGTTCTTTTCACAAACGATGCATCGTACTATGATAGTTCAGCCGAGAGTTACATCGTTGTTTGGGAAACGCACCCCAGGAAGGAACCCTGGGCACAAAAATCTCCGAGCTCTCTCCCTGGACAGCATGCCAAACTTGCAATCAGCATCAAGCATTAGCTAAGTGTGAACTCTTGAAACTAAACTAGAGTTAAAGAAGAAACGTAATAATTTTAATA[T/A]GCTGTAATCGCAGGTTACAGTGAGGATCAGGGGGCTGTAGGGGGAGCTGGAGTAGAGGACGACATGAACACCCTCCACCTGGATGAAGAGAACGAGCAGCCTCCATTAATCCTGGAAACAGACTGAGCCGCTGCCAGAAGATGGAGCCGACTGAGTGACATTGCAGAGGGGGTTTTCCTCCTCTGGTGCTGCTATGGACATGTGTGACCTGATAGAGAAAGGGATTAAAAGAGAGATCATTTTAAAGCAAGCCTAGCGGTAGCCTTATTCTGTCTGTTGTTGCGTATAGATGTTTTCCTCCTCTCCCCCTCTGCAACCTTTGTGGCTTTCTAAAAACCCTGCTGTATTTTTCTTTCAATTCCCTTTCTTTCTGTTTTTATTATTATTTCTTTAAAACTCCCAGTCCTTAATCAGACCAAACTATGAAATCTGAGCTGCAGGTGTCACGTCTCTTAGCTTTGCATGTACATGTGCCAAGATTAGAAATCCTAGAAAACCTT
Associated Phenotype:
Not determined