Busch Lab

ZMP

col9a3

Ensembl ID:
ENSDARG00000037845
ZFIN ID:
ZDB-GENE-030131-9799
Description:
Sb:cb367 protein [Source:UniProtKB/TrEMBL;Acc:A9JTG2]
Human Orthologue:
COL9A3
Human Description:
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
Mouse Orthologue:
Col9a3
Mouse Description:
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16929 Essential Splice Site Available for shipment Available now
sa13212 Essential Splice Site Available for shipment Available now
sa13060 Essential Splice Site Available for shipment Available now
sa37580 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16929
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 82 679 4 32
Genomic Location (Zv9):
Chromosome 23 (position 534142)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 505133
GRCz11 23 517926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGGGCRCTGCTGGAAGCCCAGGACTGCCAGGCCTGCCCGGTGTGGATG[T/C]AAGTCAACAWTGGAGGATTTTTCCCAATCTGGCAYCCTTTTAYTGTRTAA
Long Flanking Sequence:
TCACAGCAAGAAAGGTTTGAGTCCCAGCTGGGTCAGTTGGTGTTTCTGTATGGAGTTTGCATGTTCTCCCCATCCTCCGGGTGCTCCGGTTCCCCCCACAGTCCAAACACATGCACTATAGGGGAACTGATCAACTACACTGGCCGTAATGTATGAGTGTGTGTGTATATGAGTGTGTATGGTTGTTTCCCAGTACTGGGTTGCAGCTGGAAGGGCATCGGCTGTGTAAAATATATGCCGGAATAGTTGGCGGTTCATTCCGCTGTGGCGAATTCTGTTGTGTAGATTCAGCACTGAATGATGCATGACTTCATTATTCATTATTAACGTGCAGCAGGTTTTAAAAGCTGGTTCTGAGATTAATAAGATGTGGATCTTGTGCACAGATCATGCTTTGACTTTAAAACTCTTTATTTTGTGACTGAAGGGTCCGAAAGGAAAAGCAGGTAAAGCGGGCGCTGCTGGAAGCCCAGGACTGCCAGGCCTGCCCGGTGTGGATG[T/C]AAGTCAACAATGGAGGATTTTTCCCAATCTGGCACCCTTTTACTGTGTAAATGAAATCTATTATGCATTAAAAAACTGCCTTCTGTAGGGTTTGACTGGTCCAGACGGTCCCGCTGGCAAAGATGGACCACCAGGAGCACCAGTAAGTCATTTATTTAACTTCATCACTCCTTAGCAATTAAATCCTAATCTAATAATGCCAGACGATCTGTCATTGGAAAGGTTTAAGTCTTCTGAACACACACGTTACCTTATGTAAAACACATTTACCCTCACTCTACATCCTGTGGAGCATTTACGGTTACATATTTAAAGCATAGTGTTATAATCTAAACATTAGGCAATCGTAACAAACTATACATCATTTAAAGGAAAAGCATTTCCAGGTTTCGTATCTGGGGATTTTTTCATGATAGATATCACTGAGCAACAGTCATTTATTCATTCACAACAAGAATACTCAGAGTGGTAAAGCATTACTTTGCTACAGCAATCCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13212
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 261 679 15 32
ENSDART00000055139 Essential Splice Site 261 679 15 32
Genomic Location (Zv9):
Chromosome 23 (position 524008)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 494999
GRCz11 23 507792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGGTTCCAGAGGAAAGCCTGGAATTGCTGGCATTATTGGGAAAACCG[T/G]GAGTRACTGCCCTTTGTTTTAAARGTTTATTCTCAAWAAGGTTTARRTCA
Long Flanking Sequence:
CAGATTGAGGAGTTGTTCACAGTGTTTCCTCTAATGTTTGTTCTTCTGGAGAAAGTCTGATTAGTTTTATTTGGGCTAGAATAAAAGCAGTTTTTAATAGTGTTAAAGTCATGTTAAGCTCAATATTATTCACCCCTTCAGCAATATTAGTGTTGGATTGTCTCCAGAACACACAACTGTTATACAATGACTTGCCTAATTACCCTAACTGTACCCTAATTACCCTAGTGAAGCCTTTACATGTCACTGTAAGCTGAACACTAGTGTCTTGAAGAATATCTAGTCTAATATTATGTGCTGTCATCATGCTGAAGAGAAAAGAAAATTATTAATGATTAAAACTACTACTGTATGTTGAAATATATTTTTAAATATTTATTTTGATATATTAAAACAGATTGAACAGTTAGATGCACTCACTGAATGATCTCCGCACTCTCTGTAGGGAATACCTGGTTCCAGAGGAAAGCCTGGAATTGCTGGCATTATTGGGAAAACCG[T/G]GAGTAACTGCCCTTTGTTTTAAAGGTTTATTCTCAATAAGGTTTAGGTCAGGGCTACGGTCTTTATGTTGTGAATAATATTTGCCCTGTGTATCTTAAATAGGGGGATGTTGGAGAAAAAGGACCTCAAGGTTTTAAAGGGCCCAAAGGAGAGATAGTAAGCACTTTTTATCATCAGATCCTTGTTCACACTGCAGACCTTTCCATTTCTGTAGTATAAGGTTGACTAACGTTATCAACATCATCCTCTAAACAGGGGAAAATAGGCCCCAAGGGCGTGCCTGGAGGTGCAGGACCTAAAGGAGAACCTGTGAGGAACATATTTACAGCTTATCATTATTCAAAATATTACATTTATGTCTGATAATAATGCTGTTGTGTTGCCTAATTGTAGGGGATCCCTGGCAGGGACGGGAAGGATGGAACTCAAGGCCTGGATGGTGAAAAGGTGATAATCAGTGTGTGTTTTAAATGCGAATGTCTTTATTTATGTATTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13060
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 261 679 15 32
ENSDART00000055139 Essential Splice Site 261 679 15 32
Genomic Location (Zv9):
Chromosome 23 (position 524008)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 494999
GRCz11 23 507792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGGTTCCAGAGGAAAGCCTGGAATTGCTGGCATTATTGGGAAAACCG[T/G]GAGTRACTGCCCTTTGTTTTAAARGTTTATTCTCAAWAAGGTTTARRTCA
Long Flanking Sequence:
CAGATTGAGGAGTTGTTCACAGTGTTTCCTCTAATGTTTGTTCTTCTGGAGAAAGTCTGATTAGTTTTATTTGGGCTAGAATAAAAGCAGTTTTTAATAGTGTTAAAGTCATGTTAAGCTCAATATTATTCACCCCTTCAGCAATATTAGTGTTGGATTGTCTCCAGAACACACAACTGTTATACAATGACTTGCCTAATTACCCTAACTGTACCCTAATTACCCTAGTGAAGCCTTTACATGTCACTGTAAGCTGAACACTAGTGTCTTGAAGAATATCTAGTCTAATATTATGTGCTGTCATCATGCTGAAGAGAAAAGAAAATTATTAATGATTAAAACTACTACTGTATGTTGAAATATATTTTTAAATATTTATTTTGATATATTAAAACAGATTGAACAGTTAGATGCACTCACTGAATGATCTCCGCACTCTCTGTAGGGAATACCTGGTTCCAGAGGAAAGCCTGGAATTGCTGGCATTATTGGGAAAACCG[T/G]GAGTAACTGCCCTTTGTTTTAAAGGTTTATTCTCAATAAGGTTTAGGTCAGGGCTACGGTCTTTATGTTGTGAATAATATTTGCCCTGTGTATCTTAAATAGGGGGATGTTGGAGAAAAAGGACCTCAAGGTTTTAAAGGGCCCAAAGGAGAGATAGTAAGCACTTTTTATCATCAGATCCTTGTTCACACTGCAGACCTTTCCATTTCTGTAGTATAAGGTTGACTAACGTTATCAACATCATCCTCTAAACAGGGGAAAATAGGCCCCAAGGGCGTGCCTGGAGGTGCAGGACCTAAAGGAGAACCTGTGAGGAACATATTTACAGCTTATCATTATTCAAAATATTACATTTATGTCTGATAATAATGCTGTTGTGTTGCCTAATTGTAGGGGATCCCTGGCAGGGACGGGAAGGATGGAACTCAAGGCCTGGATGGTGAAAAGGTGATAATCAGTGTGTGTTTTAAATGCGAATGTCTTTATTTATGTATTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37580
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Nonsense 379 679 22 32
Genomic Location (Zv9):
Chromosome 23 (position 520626)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 491617
GRCz11 23 504410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTCCTCCCTCAGGGTGAGATCGGCATCCCTGGAGAGCGAGGAGAGGCC[G/T]GAGGCAGAGGTGTGGCTGTGAGTATACACTACTAAACTCTTTAAAGCTAG
Long Flanking Sequence:
TACAGCTCATGTGCTTTATTCAGTGTTAAATGCCAATAAAATCAGTGTGAATGCTGATTTACGTGATGTTTATTGCTGTACTTCTGACAGCAGCAGCAGCAGATAGTTCAGCTCAGATCTGGAGAATAAATGAAAGAGTCTGAAACTGAGCTGAGACTCAGAGCAAACCAACACATATCAGTGATTCAGCATCTACATTTAATCATGCTCCGGCATATAACGCACATGTTCACAGCAGAATATCTGACTTGAGCGTTGTTTTTCAGATAAACAGGAATGCTCACTAATTTTTAAATATCTGTCAATATTTTATGGTATTTTTATGTTTTAGTCAAAAACTTACATACAGCACCTTTAATGCATATATTAATGACTACCGGCCTCAGCTGTATCCCTTTTAGCACTATTCCCACATAATAAGTAAATTTTTGAAAAACGTTTAGTAAATGCGAGTCCTCCCTCAGGGTGAGATCGGCATCCCTGGAGAGCGAGGAGAGGCC[G/T]GAGGCAGAGGTGTGGCTGTGAGTATACACTACTAAACTCTTTAAAGCTAGGATTAATAAACTGCTTTAATCCTGAGTATTCTCATATGATATCTGCATGTTCATTAGGGTGGCGTTGGAGTACCTGGAAACACTGGACCACAAGGTGTGAAAGGATTCCAGGTGAGCTGCGCATGTGTGCATTACTGTACAACAGTGTGCGATACAACTGTTATCTCCTAATGAAGTGCAATGAACTCAATTGATTCAGTTAACTTGCGTTTGTATCTAGATATATTGCTAACTGGGGATTTAGTGAGCTTATACACACTGCAAATAATGCTTTACTTGTTTTTTACTTACTTCGTTTTTGTCTTTTTTATAGTCCAAATATCTACAAACTTTTAAATCAAGAAGCATTTTCTAGACGAGCAACACATATAGTCTTGTATGAGTAATAATGAGTCAAAATGAAGAGAGTTTTTTATTAAAACAAGCAGAATAATCTGACAATGGAGGATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6718
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055139 Essential Splice Site 426 679 24 32
Genomic Location (Zv9):
Chromosome 23 (position 519622)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 490613
GRCz11 23 503406
KASP Assay ID:
554-4915.1 (used for ordering genotyping assays)
KASP Sequence:
TCCAGGTCTGCCTGGTCCAACTGGAATCAGAGGCGGGTTTGGAGAGCGGG[T/G]CAGTCATGCACWATAATCTCTCTCAGTAATTGTGTTTGTTTGTTTCTAGA
Long Flanking Sequence:
GAATTATCGTATGTCAAATTGGAAATATATAGACCATTCTGCTTGTTTGAAGGAAAAACTCCCTTCATTTCACCTCAATAATTCTGAAAACAACACAATATTTTGTGCTTGTCTAGAAAATGCATCTTGATTTAAGGCTTTTTAGATATTTGCACTAGAAACGAGACCAAAACGTAAAGCATAGTTCTTTTAGAAAAGTGTTTTGCAGAGTGAGTGTATATCTGCACACATTTACATGAGTAAATAAACAGACTCAATGATGGGCTAAAAACTCTACGTATATTTCAGTGCATGCAGATTCAGCATGGGCCTGGTCATGACAGACGTTATTGAGCAAATGCAATATGTTAAAGGACATAAAAAAGGGAATATGGTCTAATGCATATATGTTGAAATAATTGGTAATGATGGATGAATTTGTGTGCAGGGTGTGAAAGGAGCTTTGGGAGATCCAGGTCTGCCTGGTCCAACTGGAATCAGAGGCGGGTTTGGAGAGCGGG[T/G]CAGTCATGCACAATAATCTCTCTCAGTAATTGTGTTTGTTTGTTTCTAGACTTTATTTACCCCTAAGCAGGACGTTTTTTGTATTTCAATATAGTGTGATGCAGTAAAGAATTTAAAAACAGTCAGAATTATTCACCCTCCTGGGAATCTCCTTTCCAGATATTTCCCAGATGCTGTTTCTCAGATTGAGGAGTTGTTCACAGTGTTTCCTCTAATGTTTGTCTTCTGGAGAAAGTCTTATTTGTTTAATTTGTGCTAGAATAAAGGCTGTTTTTAATAGTTTTTAACCCATTTTGAGGTCAATCTTATTAGCCACTTCAGCAATACTAGTGTTGGATTATACCCAGTAGGGTAAGCTAAATGATCCAGTTTTTGCTTTGACATATTTTTTCTCTAACCCCATTGTCAGATTATTTAACTTGTTTTCAGGAGAAACTCACTTCATTTTGACTCATTTTTTCTGAAAACACACAATATATTTATTACTTGTCTAGAAAATG
Associated Phenotype:
Not determined