Busch Lab

ZMP

UNKL

Ensembl ID:
ENSDARG00000037838
Description:
unkempt homolog (Drosophila)-like [Source:HGNC Symbol;Acc:14184]
Human Orthologue:
UNKL
Human Description:
unkempt homolog (Drosophila)-like [Source:HGNC Symbol;Acc:14184]
Mouse Orthologues:
AC122826.1, Unkl
Mouse Description:
unkempt-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1921404]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31354 Essential Splice Site Available for shipment Available now
sa31355 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5222
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003338 Nonsense 276 756 6 15
Genomic Location (Zv9):
Chromosome 3 (position 45828544)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47838097
GRCz11 3 45790431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAATGTGAGAGTGGAGACAGCTGCCAGTACTGCCACTCTCGCACCGAA[C/T]AGCAGTTCCACCCAGAGGTCAGGCTCACACACACCTGTACAACACTCTCC
Long Flanking Sequence:
ATATTTAAAAAGCTATATAATTCTACATAGATGGGCTCTGTAGCATCTAAAAGATTGAAATCTCCTGCCTTATTTACGTACTAACATGGATATTTTGGGTTTACTCCATGATAGAGTACATAGCAACTGTAGCATCATTTTTCATTGTGACCAAAAAATATATAGGCAACAAGATAAGTAAAATAGCGTAACTAGAATATTTTAAGGCTGAAGAAACTTGATTATCATTCGTCAGTATGACACCCATAGCAGCATAAAGGGCTCTTTTACCAAAATGTAATTGTCAAAAATGTATTTTCTATTTTAGTTTTTGGCTAAATGAGGAAAAAATGTTTACAAATGTTTTTGATTTATCAGTTTTTAAAACCCAAAACTTATTCACTGTTAAATGTGATGGCAGATCGACGCCCTGCCCGAGTGTGAAGCATGGAGATGAATGGGGCGAACCCTCCAAATGTGAGAGTGGAGACAGCTGCCAGTACTGCCACTCTCGCACCGAA[C/T]AGCAGTTCCACCCAGAGGTCAGGCTCACACACACCTGTACAACACTCTCCTTCAATGACTGACTTCTTCTTTTTAATCTCAATAACTTCCTTCTCTCTTTTAAGATTTACAAGTCAACTAAATGCAATGACATGAGGCAAACCGGATACTGTCCAAGGGGCCCGTTCTGTGCTTTTGCACATGTGGAAAGTAAGCATGTTCACAATGATGATCGGTTTCAATATTTTGGTGTGTTGTCAGGGTTCAGTGCTAAGGATTTTTTCTACTGGTGCGATCGGGCCAATGATTCAGATTTGTACTTGCCCTGGCAATATTTTCACTGGCTCCACCAAAAAAAAGAGAGAAGTTAATAGCTATTTTTGCCACATATTTTAAATAATCTGTCAAAAAATAATCTAGAATTTGTGAATTTAATAATCTAGAAAATGTGAATCTAGAATTTAAGTTATTTAAAAAATGTTAATAAATGTTTAATGAGCAAAATTTGAATGTGTTATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003338 Essential Splice Site 281 756 6 15
Genomic Location (Zv9):
Chromosome 3 (position 45828563)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47838116
GRCz11 3 45790450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTGCCAGTACTGCCACTCTCGCACCGAACAGCAGTTCCACCCAGAGG[T/G]CAGGCTCACACACACCTGTACAACACTCTCCTTCAATGACTGACTTCTTC
Long Flanking Sequence:
ATTCTACATAGATGGGCTCTGTAGCATCTAAAAGATTGAAATCTCCTGCCTTATTTACGTACTAACATGGATATTTTGGGTTTACTCCATGATAGAGTACATAGCAACTGTAGCATCATTTTTCATTGTGACCAAAAAATATATAGGCAACAAGATAAGTAAAATAGCGTAACTAGAATATTTTAAGGCTGAAGAAACTTGATTATCATTCGTCAGTATGACACCCATAGCAGCATAAAGGGCTCTTTTACCAAAATGTAATTGTCAAAAATGTATTTTCTATTTTAGTTTTTGGCTAAATGAGGAAAAAATGTTTACAAATGTTTTTGATTTATCAGTTTTTAAAACCCAAAACTTATTCACTGTTAAATGTGATGGCAGATCGACGCCCTGCCCGAGTGTGAAGCATGGAGATGAATGGGGCGAACCCTCCAAATGTGAGAGTGGAGACAGCTGCCAGTACTGCCACTCTCGCACCGAACAGCAGTTCCACCCAGAGG[T/G]CAGGCTCACACACACCTGTACAACACTCTCCTTCAATGACTGACTTCTTCTTTTTAATCTCAATAACTTCCTTCTCTCTTTTAAGATTTACAAGTCAACTAAATGCAATGACATGAGGCAAACCGGATACTGTCCAAGGGGCCCGTTCTGTGCTTTTGCACATGTGGAAAGTAAGCATGTTCACAATGATGATCGGTTTCAATATTTTGGTGTGTTGTCAGGGTTCAGTGCTAAGGATTTTTTCTACTGGTGCGATCGGGCCAATGATTCAGATTTGTACTTGCCCTGGCAATATTTTCACTGGCTCCACCAAAAAAAAGAGAGAAGTTAATAGCTATTTTTGCCACATATTTTAAATAATCTGTCAAAAAATAATCTAGAATTTGTGAATTTAATAATCTAGAAAATGTGAATCTAGAATTTAAGTTATTTAAAAAATGTTAATAAATGTTTAATGAGCAAAATTTGAATGTGTTATGCAAACAAATAGAGCAGTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31355
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003338 Nonsense 474 756 11 15
Genomic Location (Zv9):
Chromosome 3 (position 45843721)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47853274
GRCz11 3 45805608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTCTCTCGACAAAGAGCTAGAGGACCAAGACAACAATGGCCTTGCTT[T/A]AACAAGTAAGTGTTCTTTGTCAATGTTTGTAGTTTGGTCCTTGGTTTAGG
Long Flanking Sequence:
AGGAAGGAAGACTTAAACATGTCATGGGTTACGTTTGATTATGTGCTACGGCTTTTGAGACCCTTTTTGAAACTACTGCTGCAGACTACTTGTGTTGTACCTAAATCTTATCCGACTCCCCAGTTTCCAAAAAGCACTTACCATACACATTCATGCGTGTCACAGGTAAACTCGCAGCAGTTTATTAGAAACTATTTATTGATTAGTTTTTTTTTCCGCAGTTAATAAAATGGCAGCAAAATGTATTTGGACAGAGGATTTAAAGACTTAATTCCATGTTTCTTCAAAACATCTTCTTTTGTGTTCAACGATGACAGAATGTTAATTTGGGGTGAACTAGCCCTTTAAGAAGCTTGTGCTTTGTATGCAATTTGCAACGATTTTAAAAGCACTCCTGTTCTCTTTGCTCTTAGGATCTGCACTTGACCTAAATTTTAGTGACATCAATGTTGCCTCTCTCGACAAAGAGCTAGAGGACCAAGACAACAATGGCCTTGCTT[T/A]AACAAGTAAGTGTTCTTTGTCAATGTTTGTAGTTTGGTCCTTGGTTTAGGTTGATCTTCACTGGACTCCTTTTGCTCTGCAGGTCAGAGGTTATTAGGAGGCTCTGCTCCAGTTAATATTCCTGGCTCTCTGGCTCGGTCTTCCTCTCTGCACTCGTCATCGTCTCTGTCTGCATCTCCGCTCAGCTCCCTGTCTCAATCCCTGTCCCAGTCACTCCTCTCTGGAATGGCCTCCCAACAGAGCCAGACACAGCCACCACCTGTTAAAACCGAGCATGGCCTTCTGGGAACACCCACATCTACACAGAACTCCTTAGGTAAGGATAAGGACTCATTTTGAAGATTAAGTGTGTATGGCTCCAATAGACTTGTAGACACATACAGTCAAGCCCCGAATTATTCCTACTCCAGGGGGGAATTTTGTTCCTGGCGACCCAAGTTCGATTCCTGGCTTGTGATTCTTTGACAATCCTTCCCCTCTGTCTCTGATCCACAGTCTTC
Associated Phenotype:
Not determined