Busch Lab

ZMP

b4galt5

Ensembl ID:
ENSDARG00000037815
ZFIN ID:
ZDB-GENE-060628-3
Description:
beta-1,4-galactosyltransferase 5 [Source:RefSeq peptide;Acc:NP_001038797]
Human Orthologues:
B4GALT5, B4GALT6
Human Descriptions:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 [Source:HGNC Symbol;Acc:928]
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 [Source:HGNC Symbol;Acc:929]
Mouse Orthologues:
B4galt5, B4galt6
Mouse Descriptions:
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:192
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5021
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055099 Nonsense 352 381 9 9
Genomic Location (Zv9):
Chromosome 23 (position 4121484)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4132555
GRCz11 23 4071456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTRCTCCGTAGGTCGAAGGAGAGGCAGAGTCTGGACGGCCTGAATAACT[T/A]GAATTACTCCCCTCTAGTGTCCCGGAGGAGTCTTTAYACCAACKTGTCAG
Associated Phenotype:
Not determined