Busch Lab

ZMP

acss2

Ensembl ID:
ENSDARG00000037781
ZFIN ID:
ZDB-GENE-040718-388
Description:
acetyl-coenzyme A synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_001002641]
Human Orthologue:
ACSS2
Human Description:
acyl-CoA synthetase short-chain family member 2 [Source:HGNC Symbol;Acc:15814]
Mouse Orthologue:
Acss2
Mouse Description:
acyl-CoA synthetase short-chain family member 2 Gene [Source:MGI Symbol;Acc:MGI:1890410]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37622 Nonsense Mutation detected in F1 DNA Not yet available
sa24258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37622
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 None None 415 None 11
ENSDART00000125122 Nonsense 263 698 8 19
ENSDART00000138745 None None 269 None 9
ENSDART00000141235 Nonsense 263 422 8 11
Genomic Location (Zv9):
Chromosome 23 (position 9367175)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9325316
GRCz11 23 9260286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCTTTCAGTGTGAGTAACCTCTCCATTAACCCCCTTTAGCAGGAGAAA[C/T]AGAAAGAAAGAGTAAGGAAGGTCCGTCCCCCTCCACAGGTATTTCATGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3251
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Nonsense 84 415 2 11
ENSDART00000125122 Nonsense 367 698 10 19
ENSDART00000138745 None None 269 None 9
ENSDART00000141235 Nonsense 367 422 10 11
Genomic Location (Zv9):
Chromosome 23 (position 9379623)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9337764
GRCz11 23 9272734
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTGCACCGCTGACATCGGCTGGATCACCGGCCACTCATACATCACGTA[T/A]GGGCCCTTGGCCAATGGGGCGACMAGTGTGTTGGTAAGGGGAACACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055054 Essential Splice Site 95 415 2 11
ENSDART00000125122 Essential Splice Site 378 698 10 19
ENSDART00000138745 None None 269 None 9
ENSDART00000141235 Essential Splice Site 378 422 10 11
Genomic Location (Zv9):
Chromosome 23 (position 9379658)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9337799
GRCz11 23 9272769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATACATCACGTATGGGCCCTTGGCCAATGGGGCGACCAGTGTGTTGG[T/C]AAGGGGAACACCCTGATAAGCATTATTTGTGTCAGATTTTTGCATAATGC
Associated Phenotype:
Not determined