Busch Lab

ZMP

tlr2

Ensembl ID:
ENSDARG00000037758
ZFIN ID:
ZDB-GENE-040219-6
Description:
toll-like receptor 2 [Source:RefSeq peptide;Acc:NP_997977]
Human Orthologue:
TLR2
Human Description:
toll-like receptor 2 [Source:HGNC Symbol;Acc:11848]
Mouse Orthologue:
Tlr2
Mouse Description:
toll-like receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1346060]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39548 Nonsense Mutation detected in F1 DNA Not yet available
sa19423 Nonsense Available for shipment Available now
sa6574 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39548
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 121 788 1 1
ENSDART00000122568 Nonsense 151 818 2 2
Genomic Location (Zv9):
Chromosome 1 (position 8062583)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8302388
GRCz11 1 8986499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCTTAAACAACCTGAACAATCTCTCTCCGTCTTGGTTTCACAAGT[T/A]AAAATCTCTCCAGCAACTTAACCTTGTAGGAAACCCATACTCAACTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19423
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 519 788 1 1
ENSDART00000122568 Nonsense 549 818 2 2
Genomic Location (Zv9):
Chromosome 1 (position 8063777)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8303582
GRCz11 1 8987693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACATTGCTGATACAAAGGAACGCCTTACGGATGTTCAACCAAAGCTCTT[T/A]GAGGAGTTTTAAAACTCTGCTTTACTTGGAGGCAGGTGCCAACAATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6574
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055006 Nonsense 695 788 1 1
ENSDART00000122568 Nonsense 725 818 2 2
Genomic Location (Zv9):
Chromosome 1 (position 8064304)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8304109
GRCz11 1 8988220
KASP Assay ID:
554-5103.1 (used for ordering genotyping assays)
KASP Sequence:
GGGACTTCAGRCCGGGCCGCTGGATCGTGGACAAYATCATTGACTCAATT[G/T]AAAAGAGCTATCGAACTCTKTTTGTTCTGTCGGAGCACTTTGTGAGCAGT
Associated Phenotype:
Not determined