Busch Lab

ZMP

zgc:112980

Ensembl ID:
ENSDARG00000037739
ZFIN ID:
ZDB-GENE-050306-1
Description:
hypothetical protein LOC503706 [Source:RefSeq peptide;Acc:NP_001013318]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25521 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25521
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054981 Nonsense 407 715 13 21
ENSDART00000135197 None None 229 None 6

The following transcripts of ENSDARG00000037739 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 7622844)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7862649
GRCz11 1 8546760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGATAACACACAAATGAGTGTTATTTGTGTGTTAAGGTTGGAGACTA[C/A]ACGGGTGCAGTCCAAACCATGTTATCCCCAATGCTTGGTGCTCCTTCCTC
Associated Phenotype:
Not determined