Busch Lab

ZMP

pmm2

Ensembl ID:
ENSDARG00000037654
ZFIN ID:
ZDB-GENE-030722-6
Description:
phosphomannomutase 2 [Source:RefSeq peptide;Acc:NP_956378]
Human Orthologue:
PMM2
Human Description:
phosphomannomutase 2 [Source:HGNC Symbol;Acc:9115]
Mouse Orthologue:
Pmm2
Mouse Description:
phosphomannomutase 2 Gene [Source:MGI Symbol;Acc:MGI:1859214]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10150 Essential Splice Site Available for shipment Available now
sa18686 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19432 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2024
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 119 250 5 8
Genomic Location (Zv9):
Chromosome 1 (position 8941425)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181230
GRCz11 1 9865341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTTGTAATAAATARATAAACCACAATATTTATGTTATTATTACGTTTC[A/T]GAGGCACATTTATTGAATTTCGGAATGGAATGCTGAATGTCTCTCCGATC
Long Flanking Sequence:
TTTTCTATTTTCAAAAGGGGGTGTACTCATTTATGCTGAGCACTGTATATTACTTTTATTCAATATATCAAATGTATTACAATTAAAAATAAGCTGACTTTTTTTTTTTTTTTTAAATATACATCTATGAGGCAGCATGGTGGACCCCGCTGGGCCAGTTGGCATTTCTGTGTGGAGTTTGCATGGGTTTCCTCAGGGTGCAACTAAATTGGCCGTTGTGGATTAGTGCGCGAGTGTATGGGTGTTTCCCAGTACTGGTTGCAGCTGGAAATGCTTAAACGTATGCCAGAATAGTTGACGGTTCATTCCACTGTGGCGACTGCTGATAATTAAGGAAAATAAATTGATGAAATATAAATCTATATTCAATAGTTTTTGGATAAATTTGATGAAAGGTTCCAATTCAGAATGTGATTTTAATTTGCTGTACATTTATTTTATATACATAAACATTTGTAATAAATAGATAAACCACAATATTTATGTTATTATTACGTTTC[A/T]GAGGCACATTTATTGAATTTCGGAATGGAATGCTGAATGTCTCTCCGATCGGTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAGGTTGTTTGTTTTACACATGTATCAACACACAATGCCCTAATCTTCTTAAAGGATGCCATCTAAAGTTTAATTAAATGTATGTTTTTATGCAGAAGGAGAAGATTAGAGAAACATTTGTCTCCGTTTTAAAAGAAGAGTTTGCTGGGAAGGGACTAGCTTTCTCCATTGGTAAGAAACGAGTGTTAATGAATCTTTTAATGTGCCGTCAAATTATTTTTCTAAATAATACGAAGTTTGCACTGAATATATTTGACATAATACTGTCATTCTTACACTAAATTACAGACTGTGTTTTCTGTAAATCATGCTATAAATATATGAAAGTCATTATTTTACATGCATTTAATCTACATGAAAAAATGTAGCACTGCTACTTTCTTCCTTGAAATGATGCTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10150
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 152 250 5 8
ENSDART00000054848 Essential Splice Site 152 250 5 8
Genomic Location (Zv9):
Chromosome 1 (position 8941527)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181332
GRCz11 1 9865443
KASP Assay ID:
2259-0209.1 (used for ordering genotyping assays)
KASP Sequence:
GTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAG[G/A]TTGTTTGTTTTACACATGTATCAACACACAATGCCMTWATCTTCTYAAAG
Long Flanking Sequence:
TTTTTTTTTTTTAAATATACATCTATGAGGCAGCATGGTGGACCCCGCTGGGCCAGTTGGCATTTCTGTGTGGAGTTTGCATGGGTTTCCTCAGGGTGCAACTAAATTGGCCGTTGTGGATTAGTGCGCGAGTGTATGGGTGTTTCCCAGTACTGGTTGCAGCTGGAAATGCTTAAACGTATGCCAGAATAGTTGACGGTTCATTCCACTGTGGCGACTGCTGATAATTAAGGAAAATAAATTGATGAAATATAAATCTATATTCAATAGTTTTTGGATAAATTTGATGAAAGGTTCCAATTCAGAATGTGATTTTAATTTGCTGTACATTTATTTTATATACATAAACATTTGTAATAAATAGATAAACCACAATATTTATGTTATTATTACGTTTCAGAGGCACATTTATTGAATTTCGGAATGGAATGCTGAATGTCTCTCCGATCGGTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAG[G/A]TTGTTTGTTTTACACATGTATCAACACACAATGCCCTAATCTTCTTAAAGGATGCCATCTAAAGTTTAATTAAATGTATGTTTTTATGCAGAAGGAGAAGATTAGAGAAACATTTGTCTCCGTTTTAAAAGAAGAGTTTGCTGGGAAGGGACTAGCTTTCTCCATTGGTAAGAAACGAGTGTTAATGAATCTTTTAATGTGCCGTCAAATTATTTTTCTAAATAATACGAAGTTTGCACTGAATATATTTGACATAATACTGTCATTCTTACACTAAATTACAGACTGTGTTTTCTGTAAATCATGCTATAAATATATGAAAGTCATTATTTTACATGCATTTAATCTACATGAAAAAATGTAGCACTGCTACTTTCTTCCTTGAAATGATGCTTGTCTTTGACTCATGTATGTATTTTTCCCTGCAGGTGGACAGATCAGTTTTGATGTGTTTCCAGAAGGCTGGGATAAGCGCTACTGTTTGGGAATTGTGGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 152 250 5 8
ENSDART00000054848 Essential Splice Site 152 250 5 8
Genomic Location (Zv9):
Chromosome 1 (position 8941527)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181332
GRCz11 1 9865443
KASP Assay ID:
2259-0209.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAG[G/A]TTGTTTGTTTTACACATGTATCAACACACAATGCCCTAATCTTCTTAAAG
Long Flanking Sequence:
TTTTTTTTTTTTAAATATACATCTATGAGGCAGCATGGTGGACCCCGCTGGGCCAGTTGGCATTTCTGTGTGGAGTTTGCATGGGTTTCCTCAGGGTGCAACTAAATTGGCCGTTGTGGATTAGTGCGCGAGTGTATGGGTGTTTCCCAGTACTGGTTGCAGCTGGAAATGCTTAAACGTATGCCAGAATAGTTGACGGTTCATTCCACTGTGGCGACTGCTGATAATTAAGGAAAATAAATTGATGAAATATAAATCTATATTCAATAGTTTTTGGATAAATTTGATGAAAGGTTCCAATTCAGAATGTGATTTTAATTTGCTGTACATTTATTTTATATACATAAACATTTGTAATAAATAGATAAACCACAATATTTATGTTATTATTACGTTTCAGAGGCACATTTATTGAATTTCGGAATGGAATGCTGAATGTCTCTCCGATCGGTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAG[G/A]TTGTTTGTTTTACACATGTATCAACACACAATGCCCTAATCTTCTTAAAGGATGCCATCTAAAGTTTAATTAAATGTATGTTTTTATGCAGAAGGAGAAGATTAGAGAAACATTTGTCTCCGTTTTAAAAGAAGAGTTTGCTGGGAAGGGACTAGCTTTCTCCATTGGTAAGAAACGAGTGTTAATGAATCTTTTAATGTGCCGTCAAATTATTTTTCTAAATAATACGAAGTTTGCACTGAATATATTTGACATAATACTGTCATTCTTACACTAAATTACAGACTGTGTTTTCTGTAAATCATGCTATAAATATATGAAAGTCATTATTTTACATGCATTTAATCTACATGAAAAAATGTAGCACTGCTACTTTCTTCCTTGAAATGATGCTTGTCTTTGACTCATGTATGTATTTTTCCCTGCAGGTGGACAGATCAGTTTTGATGTGTTTCCAGAAGGCTGGGATAAGCGCTACTGTTTGGGAATTGTGGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054848 Essential Splice Site 178 250 7 8
Genomic Location (Zv9):
Chromosome 1 (position 8941954)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9181759
GRCz11 1 9865870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCTTGAAATGATGCTTGTCTTTGACTCATGTATGTATTTTTCCCTGC[A/T]GGTGGACAGATCAGTTTTGATGTGTTTCCAGAAGGCTGGGATAAGCGCTA
Long Flanking Sequence:
AATGCTGAATGTCTCTCCGATCGGTCGAAGCTGCAGCCAACAGGAAAGAATCGAATTCTTTGAACTTGATAAGGTTGTTTGTTTTACACATGTATCAACACACAATGCCCTAATCTTCTTAAAGGATGCCATCTAAAGTTTAATTAAATGTATGTTTTTATGCAGAAGGAGAAGATTAGAGAAACATTTGTCTCCGTTTTAAAAGAAGAGTTTGCTGGGAAGGGACTAGCTTTCTCCATTGGTAAGAAACGAGTGTTAATGAATCTTTTAATGTGCCGTCAAATTATTTTTCTAAATAATACGAAGTTTGCACTGAATATATTTGACATAATACTGTCATTCTTACACTAAATTACAGACTGTGTTTTCTGTAAATCATGCTATAAATATATGAAAGTCATTATTTTACATGCATTTAATCTACATGAAAAAATGTAGCACTGCTACTTTCTTCCTTGAAATGATGCTTGTCTTTGACTCATGTATGTATTTTTCCCTGC[A/T]GGTGGACAGATCAGTTTTGATGTGTTTCCAGAAGGCTGGGATAAGCGCTACTGTTTGGGAATTGTGGAGAAAGACTCCTATCAGCACATCCATTTCTTTGGAGACAAAACAATGCCTGTGAGTCCAAGATGCAGTTTCGACTAATTCAAGTATTCATACACGTACTTCATTTACATACTGCACTATTCCAGACTAGCCTAATGTCAATATTTATCTTTAGCAAAAATTTTATTCTTGAGGTAAACAATTTAATTCACTAAAACCTCTTTTTATTTTGGTTATGTTTATTCAAAATCGAGTCATTTGCTTCCGTCCTGAAGTGACACTCCTCCTCTGATGAGTGAAATATGTTTAGCCACGCCCTTCCAACTACTACTATGCTGCGAAAGATGAGAGGAGGAGCATAAAACCCCGCCCCTACTCAATATTCAGTTTCAGATATAAATACGTCATCATACTAAAGCAAAAATCTGGATCAACTTCTAGTTCACGTAGACTCT
Associated Phenotype:
Not determined