Busch Lab

ZMP

slco1f1

Ensembl ID:
ENSDARG00000037605
ZFIN ID:
ZDB-GENE-040426-2192
Description:
solute carrier organic anion transporter family, member 1F1 [Source:RefSeq peptide;Acc:NP_998082]
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25314 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30868 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25314
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109380 Essential Splice Site 410 565 8 12
Genomic Location (Zv9):
Chromosome 5 (position 62641850)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70581757
GRCz11 4 72097427
KASP Assay ID:
554-7493.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTTGCCATGCGGGCTGCAATTCCACCCAGGGTGCAGGATGGAATAAG[G/A]TGAATGCAGCGAATAACAATCTTACACTATCTCCTTCAATTATTACATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30868
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109380 Nonsense 544 565 12 12
Genomic Location (Zv9):
Chromosome 5 (position 62646140)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70577467
GRCz11 4 72093096
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTATTTGCCCCTATAAGGTTCCTCTTTCAGGGAATGACCATCGGCCTT[C/T]GAGTATTAGCCTGTTCCGTGCTCTGGATAGCCACCATAGAGATAAAGAGA
Associated Phenotype:
Not determined