Busch Lab

ZMP

pm20d1.1

Ensembl ID:
ENSDARG00000037551
ZFIN ID:
ZDB-GENE-051120-102
Description:
Probable carboxypeptidase PM20D1.1 [Source:UniProtKB/Swiss-Prot;Acc:Q32LT9]
Human Orthologue:
PM20D1
Human Description:
peptidase M20 domain containing 1 [Source:HGNC Symbol;Acc:26518]
Mouse Orthologue:
Pm20d1
Mouse Description:
peptidase M20 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442939]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa17258 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054681 Nonsense 160 515 3 13
ENSDART00000136967 Nonsense 160 515 3 13
ENSDART00000139695 None None 169 None 7
Genomic Location (Zv9):
Chromosome 23 (position 18197961)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18100900
GRCz11 23 18027243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTGCCGGCTAATGAGGCRGATGGATGGGACGCTCCTCCTTTCTCTGCA[C/T]AGGAGATCRATGGATTCATTTAYGGACGAGGAACCATCGAYAATAAACAG
Associated Phenotype:
Not determined