Busch Lab

ZMP

tnnc1b

Ensembl ID:
ENSDARG00000037539
ZFIN ID:
ZDB-GENE-040625-62
Description:
slow-specific troponin C [Source:RefSeq peptide;Acc:NP_001002085]
Human Orthologue:
TNNC1
Human Description:
troponin C type 1 (slow) [Source:HGNC Symbol;Acc:11943]
Mouse Orthologues:
AC154446.1, Tnnc1
Mouse Descriptions:
troponin C, cardiac/slow skeletal Gene [Source:MGI Symbol;Acc:MGI:98779]
troponin C, slow skeletal and cardiac muscles [Source:RefSeq peptide;Acc:NP_033419]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa29906 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054664 Essential Splice Site 106 161 5 6
Genomic Location (Zv9):
Chromosome 23 (position 20400678)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20185785
GRCz11 23 20112128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGTTGGCCTCAAAATCTATTGCAAAACCACGTTTTATTGTCCTGTTA[A/C]GAAATGGAGATGGTTACATTGACTTGGATGAGCTGAAGAACATGCTGGAG
Associated Phenotype:
Not determined