Busch Lab

ZMP

si:rp71-17i16.5

Ensembl ID:
ENSDARG00000037527
ZFIN ID:
ZDB-GENE-090312-117
Human Orthologue:
PIK3CG
Human Description:
phosphoinositide-3-kinase, catalytic, gamma polypeptide [Source:HGNC Symbol;Acc:8978]
Mouse Orthologue:
Pik3cg
Mouse Description:
phosphoinositide-3-kinase, catalytic, gamma polypeptide Gene [Source:MGI Symbol;Acc:MGI:1353576]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45793 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45793
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054651 Nonsense 517 1034 2 11
ENSDART00000133373 Nonsense 132 637 1 10
Genomic Location (Zv9):
Chromosome 23 (position 20650128)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20435235
GRCz11 23 20361578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCTTCTTCAACAGCAACCTTAACAAGAATGAGGAACCTAAAAAAGTTC[A/T]AAGAAGAAAGTGTCCACTATGTCTCAAATTTACCTCAGTTTCTTCGCACA
Associated Phenotype:
Not determined