Busch Lab

ZMP

hdac3

Ensembl ID:
ENSDARG00000037514
ZFIN ID:
ZDB-GENE-040426-847
Description:
Histone deacetylase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q803C3]
Human Orthologue:
HDAC3
Human Description:
histone deacetylase 3 [Source:HGNC Symbol;Acc:4854]
Mouse Orthologue:
Hdac3
Mouse Description:
histone deacetylase 3 Gene [Source:MGI Symbol;Acc:MGI:1343091]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35650 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa22434 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35650
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054626 Splice Site, Nonsense 18 428 1 15

The following transcripts of ENSDARG00000037514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12437396)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11873169
GRCz11 14 12179183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAATCGAACTGCGTACTTCTACGACCCAGACGTGGGGAACTTTCACTA[T/A]GGTAAGATTTTAACGTATCGTATAGCATAGGTTGCTAATGGATGATAACG
Long Flanking Sequence:
TAAATGCAGAGTTGCTGCCATGTGTTTGACTGTGACATGTGTTAAGGAGCAGTTGGACTGGTGTACCTTATAAAGTGGCCGGTGAGTGTATTACAGTGTAGATCATAATGTAGAGAAACACAACAAGGATACAACAATAAGGTGCAAAAATATGACATTATAACTAATAGGCAATAGAAAATTCATAATGGACACGGTAAATTTAAGACGATATAGTCTAATTTCCCTTCTCTCCTTCGCATTGCCACTCCACACCCCAGTTCAGTTGGTGGCGGTAAGGCACCAAAAGTTGGATTTGACACCATCAAGAAGAAGAAGAAGCGGAAGTGATTTTTTTTTGCTGTTTTAGAGAAGATGGCGGCGGCGTTGAACAGAAATTAGAATAATTAAAACATTTTTGTTTTCTCGTGCTAGAAATAACTGCTTTTATTTACACTCTGTTGCAACATGACCAATCGAACTGCGTACTTCTACGACCCAGACGTGGGGAACTTTCACTA[T/A]GGTAAGATTTTAACGTATCGTATAGCATAGGTTGCTAATGGATGATAACGCTTAAATTACTGTTTACTCCTGTATGCGGCGATGCCCAGATGAGAAAAAATGCTATAAAAATGTTGTAAGAACTATAGTATTTTAGAAACATACTATAGTGTAAATATCGGCCTATAGTATTTACAACACTTGTTAATGAATTCTACTGCGGACTGTAATACTGTACTATATTTTAGGTGTTTACAACAATAAACTATGCTCTATTATAGTATAGTTTACCCTGTAGTTGTGGAGAATAGTGTAAGTGGTTCTACTATGTGTCTATACTTGTATTACAAAAGCTACTGTAGAATTACCCCAATAGATTAATTTAAGTGTTAATGTTTTACTTTAATTATTGAATAAAATGCATTATTATTATTAATATTAATATTAATAATATTATTGTTTTTAAATTAACCTTAATTAGTTTGCCCAGCTATAGCTGTTTACATCAACATTGCCTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22434
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054626 Essential Splice Site 46 428 2 15

The following transcripts of ENSDARG00000037514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12446704)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11882477
GRCz11 14 12188491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCACACATAGTCTTGTACTTCATTATGGACTATACAAGAAGATGATGG[T/A]AGGAAAAACTGCTTAAAAATCTTTTTTTAGTCCAATCTCTTTTCTCTTTT
Long Flanking Sequence:
ACACTGGAATACACGCAAGGATTTAATCAGTGTGACACAGCTTCAAAAATTAGTTTCAAACCGGAAGAGCAAATTTGCTCGAAATAACGCAGAAACAACCAATTTTCACTTTTTTGTGAAATATATGTGTCTTAATGGTGTTTATAGCAGCGTGTGAAACATATATGACACATAAATGTGTTTTGGTGTTTCGCGACCTTTTTACTTTTATCTTTTTTCCTCCAGGCTCCTAGTCTCTCACTATAACATATTTGCCATCTAGTGGTTATAGTTTCAAGAGTAACAGCATGATCAATTGATGTAATCATAGTAAAAAAGCTTTTTTTTTGTCTAAAATAGCAAGACCTTGGCAGTTTGATGTGAACTTAAATTACCTTTTTTTCATTCATTCTTCTCTGTTTCTTTTTATGCTCCAGGTGCTGGGCATCCAATGAAACCTCATAGACTATCACTCACACATAGTCTTGTACTTCATTATGGACTATACAAGAAGATGATGG[T/A]AGGAAAAACTGCTTAAAAATCTTTTTTTAGTCCAATCTCTTTTCTCTTTTGAAATAATTCTCGTCCTTATGAGCAAAGCATTTGTTTTCAGGTTTTCAAACCCTACAAGGCATCCCAGCATGACATGTGCAGGTTCCACTCTGAGGATTACATAGACTTTCTGCAGAAGGTCAGTCCAAACAACATGCAGGGCTTCACAAAGAGTCTCAACACTTTCAATGTAGGAGATGACTGGTAAGTTTCCTTCCATTTATAAAAATGCTTTTAAAGTAAATATTTAAAGTAACAGTTTAACAGCACATGATATATGTCAGTCTTTTTAAACATTGATTGAGTTTTTGGTTAAGAAAGTAGCAACTCTATTTGATATAATATGTAGTTATGCTTTAAAACATTAGATTAAATAAGAGTTTTCTAATAATCAGGGTTTTTTTGTTTTTTTTTGTTCTAAGTCCTGTCTTTCCAGGTCTGTTTGAGTTTTGTTCAAGATACACAGGTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28275
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054626 Nonsense 118 428 4 15

The following transcripts of ENSDARG00000037514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12447228)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11883001
GRCz11 14 12189015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTTTTGTTCAAGATACACAGGTGCCTCATTACAAGGAGCAACTCAGT[T/G]AAATCACAAGGTTTGTAGAGAGTAGAAATGTTGCCCTTACACATTCATCG
Long Flanking Sequence:
TTTTTAGTCCAATCTCTTTTCTCTTTTGAAATAATTCTCGTCCTTATGAGCAAAGCATTTGTTTTCAGGTTTTCAAACCCTACAAGGCATCCCAGCATGACATGTGCAGGTTCCACTCTGAGGATTACATAGACTTTCTGCAGAAGGTCAGTCCAAACAACATGCAGGGCTTCACAAAGAGTCTCAACACTTTCAATGTAGGAGATGACTGGTAAGTTTCCTTCCATTTATAAAAATGCTTTTAAAGTAAATATTTAAAGTAACAGTTTAACAGCACATGATATATGTCAGTCTTTTTAAACATTGATTGAGTTTTTGGTTAAGAAAGTAGCAACTCTATTTGATATAATATGTAGTTATGCTTTAAAACATTAGATTAAATAAGAGTTTTCTAATAATCAGGGTTTTTTTGTTTTTTTTTGTTCTAAGTCCTGTCTTTCCAGGTCTGTTTGAGTTTTGTTCAAGATACACAGGTGCCTCATTACAAGGAGCAACTCAGT[T/G]AAATCACAAGGTTTGTAGAGAGTAGAAATGTTGCCCTTACACATTCATCGTTAACATTTTTCTTTAAACCTGACAAAAATTTAATAAACAGCATTTGCATAATAATGTGGGGGAAATAATGGTAGATGTAATAACATTATCTTTTTGCACAATTGTTTTCTGCGGGCCAGATTCACTATTCTTTTGATCCTGTTTTGTATGTCTTTTGTATCTGTATCTATTTTACAGAAAAAAGAAAAAGTGCCATGAAAAGATTAAGTGGCTTTTTAAGAACCATGCTGACCAAGCCACTGTGCTTTTCTGATGTGCTGCGATCTACTTGTTTTTCACTGTTAAATTTAGCTTTTTCTGGGACTTGCTCAATAAGGATCACATGCCTAATTGAGTTCATATCCACACCCTCATAACAAAATTAAGAAAAGAAAAAAAGTTATATGGATTACAATTTATATAGAATTATATGGTTTACAATTTTTACTTACAAATCCAACATACAGAGT
Associated Phenotype:
Not determined