Busch Lab

ZMP

gria3b

Ensembl ID:
ENSDARG00000037498
ZFIN ID:
ZDB-GENE-030616-53
Description:
glutamate receptor, ionotrophic, AMPA 3 precursor [Source:RefSeq peptide;Acc:NP_938174]
Human Orthologue:
GRIA3
Human Description:
glutamate receptor, ionotrophic, AMPA 3 [Source:HGNC Symbol;Acc:4573]
Mouse Orthologue:
Gria3
Mouse Description:
glutamate receptor, ionotropic, AMPA3 (alpha 3) Gene [Source:MGI Symbol;Acc:MGI:95810]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6340 Nonsense Mutation detected in F1 DNA Not yet available
sa35652 Nonsense Available for shipment Available now
sa42362 Nonsense Mutation detected in F1 DNA Not yet available
sa22436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6340
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 11 883 1 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 13095178)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12530951
GRCz11 14 12836965
KASP Assay ID:
554-4458.1 (used for ordering genotyping assays)
KASP Sequence:
TTGAGAGAAGCTGAAAAAAANTGACTCAAAGCGCGTTGATTTTTTTATTAT[G/A]GCTTTTCGGCACGTCTCTCGCTGGCTTCCCCAATCAGATAAATATCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35652
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 126 883 3 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 13035948)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12471721
GRCz11 14 12777735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCCACACCTCCTTTGTCACACCCAGTTACCCCATCGACTCAGATGTG[C/T]AGTTTGTCATCCAGATGCGCCCTCCATTGAAGGGTGCTGTCTTAAGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42362
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 249 883 6 15
Genomic Location (Zv9):
Chromosome 14 (position 12912403)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12348176
GRCz11 14 12654190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTCATAATCTCTTTTCACAGGGCTTCACCAACATTAGCCTGGAC[A/T]AGGTCTTCCTTGGTGGAGCAAACATTAGTGGATTTCAGATAATTAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22436
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043180 Nonsense 739 883 13 15
Genomic Location (Zv9):
Chromosome 14 (position 12813098)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12248871
GRCz11 14 12554885
KASP Assay ID:
2260-7344.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCTTGAATCCACCATGAATGAATACATTGAGCAGAGGAAGCCCTG[C/A]GACACGATGAAAGTGGGCGGCAATCTGGACTCTAAGGGCTATGGTGTGGC
Associated Phenotype:
Not determined