Busch Lab

ZMP

rtn4rl2b

Ensembl ID:
ENSDARG00000037495
ZFIN ID:
ZDB-GENE-040310-2
Description:
reticulon 4 receptor-like 2b [Source:RefSeq peptide;Acc:NP_982350]
Human Orthologue:
RTN4RL2
Human Description:
reticulon 4 receptor-like 2 [Source:HGNC Symbol;Acc:23053]
Mouse Orthologue:
Rtn4rl2
Mouse Description:
reticulon 4 receptor-like 2 Gene [Source:MGI Symbol;Acc:MGI:2669796]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35658 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28280
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054598 Nonsense 421 457 3 3
Genomic Location (Zv9):
Chromosome 14 (position 15032028)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16894014
GRCz11 14 17199667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCAAACTATGGAAATGAGGATGCAGCCTCAGTTCGCTGTTTCGAACTT[G/T]AATGTCCACCAGGTTACGACTCTCCCATTCTCCCATCTTCCTCTTCGTCT
Long Flanking Sequence:
GTCAGGCGTTAAGGGATACATCATCCGTGCAGTTTCTCAGGCTCAATGGAAACCCCTGGACCTGCGGTTGTGAAGCAAGGTCACTCTGGGAGTGGTTCCGCAAAGCTCGGATTTCCAGCTCAGACCTAACCTGCTCTTCACCAGCCCCCCGTAAAGGCCAGGACCTGAGATTCCTGCGGGAGCTAGACTTTGCTCTCTGCCCCTTGCCTGACCCAGGTTCCATGGCAGGCACTACAACCACCACTTTCAGCACCAAAACACGTTGGTGGTTCTCAAAGAACAAGCCAGCCTCATCATCCAAGAGCCACTTTCATAAGAGCAGTGAGACCTTGAAGGCCTTCCCATTCAACTCTGGCAAGAATCCCTCATCTTCATCGACTTCCTTCTCATCCAAGTACGATCTCACAGCAGAGGAGGCTGCCTTACCCAAGCTGGAGCCTGAAGAGTACTGGGCAAACTATGGAAATGAGGATGCAGCCTCAGTTCGCTGTTTCGAACTT[G/T]AATGTCCACCAGGTTACGACTCTCCCATTCTCCCATCTTCCTCTTCGTCTTCACTTCTGTCTTTCCTCTCACTCACAGCACTGACTCTTTCTTTCCATCTGCTCTTCGGCTGAGTCTTTTTCTCCTCCTCTTCCTCTTCTGTTATCCTACACTACCTTTCTCCTGCGATCGGGCTTATGCTGATAAATGCATATAAGCAGCAATGCAGAAAAAAAGGGTGACAAGAAACTGGCACAGAACAACAACATTTATACAACGCATACTGTAAGGTGCAATATATGCAGAACAACTGAGCCAGGGATGAAGCATGTGTGCACCCCCAAAAGGCTTTGCAACACCAGCTCAAGTCATGTCCTTCTCTATAATGAGAGAATATAGGACAAGTAGAGGGGTAAAGAGGGACTGATGTGGTAAATGAAACTAGAGGTAAAGACGGCAAGGAAAGTCTCGACACAAAGAGAAAACTCTAAAACCAGCAACTGAGACTGTACCAGTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35658
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054598 Nonsense 426 457 3 3
Genomic Location (Zv9):
Chromosome 14 (position 15032045)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16894031
GRCz11 14 17199684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGATGCAGCCTCAGTTCGCTGTTTCGAACTTGAATGTCCACCAGGTTA[C/A]GACTCTCCCATTCTCCCATCTTCCTCTTCGTCTTCACTTCTGTCTTTCCT
Long Flanking Sequence:
ACATCATCCGTGCAGTTTCTCAGGCTCAATGGAAACCCCTGGACCTGCGGTTGTGAAGCAAGGTCACTCTGGGAGTGGTTCCGCAAAGCTCGGATTTCCAGCTCAGACCTAACCTGCTCTTCACCAGCCCCCCGTAAAGGCCAGGACCTGAGATTCCTGCGGGAGCTAGACTTTGCTCTCTGCCCCTTGCCTGACCCAGGTTCCATGGCAGGCACTACAACCACCACTTTCAGCACCAAAACACGTTGGTGGTTCTCAAAGAACAAGCCAGCCTCATCATCCAAGAGCCACTTTCATAAGAGCAGTGAGACCTTGAAGGCCTTCCCATTCAACTCTGGCAAGAATCCCTCATCTTCATCGACTTCCTTCTCATCCAAGTACGATCTCACAGCAGAGGAGGCTGCCTTACCCAAGCTGGAGCCTGAAGAGTACTGGGCAAACTATGGAAATGAGGATGCAGCCTCAGTTCGCTGTTTCGAACTTGAATGTCCACCAGGTTA[C/A]GACTCTCCCATTCTCCCATCTTCCTCTTCGTCTTCACTTCTGTCTTTCCTCTCACTCACAGCACTGACTCTTTCTTTCCATCTGCTCTTCGGCTGAGTCTTTTTCTCCTCCTCTTCCTCTTCTGTTATCCTACACTACCTTTCTCCTGCGATCGGGCTTATGCTGATAAATGCATATAAGCAGCAATGCAGAAAAAAAGGGTGACAAGAAACTGGCACAGAACAACAACATTTATACAACGCATACTGTAAGGTGCAATATATGCAGAACAACTGAGCCAGGGATGAAGCATGTGTGCACCCCCAAAAGGCTTTGCAACACCAGCTCAAGTCATGTCCTTCTCTATAATGAGAGAATATAGGACAAGTAGAGGGGTAAAGAGGGACTGATGTGGTAAATGAAACTAGAGGTAAAGACGGCAAGGAAAGTCTCGACACAAAGAGAAAACTCTAAAACCAGCAACTGAGACTGTACCAGTTATGAATGACCGTCACATTGTC
Associated Phenotype:
Not determined