Busch Lab

ZMP

sorbs3

Ensembl ID:
ENSDARG00000037476
ZFIN ID:
ZDB-GENE-050327-1
Description:
vinexin [Source:RefSeq peptide;Acc:NP_001014312]
Human Orthologue:
SORBS3
Human Description:
sorbin and SH3 domain containing 3 [Source:HGNC Symbol;Acc:30907]
Mouse Orthologue:
Sorbs3
Mouse Description:
sorbin and SH3 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:700013]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41265 Nonsense Mutation detected in F1 DNA Not yet available
sa13984 Nonsense Available for shipment Available now
sa15686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41265
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559 None None 564 None 18
ENSDART00000112991 Nonsense 119 261 2 4
ENSDART00000127830 Nonsense 134 308 3 5
ENSDART00000129597 None None 577 None 21
ENSDART00000132077 None None 160 None 8
ENSDART00000134100 None None 248 None 7
ENSDART00000134283 None None 617 None 18
ENSDART00000146378 None None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39494111)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38372914
GRCz11 8 38405853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGACAAACTCACCACTTTACGCGGCAGTTGTAGTTCCCGTGAACACTTG[T/A]CGACCTGGCTCAGATATTCAGTTTTGGTTGAAGAAGAATGGCTGTCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559 None None 564 None 18
ENSDART00000112991 Nonsense 166 261 2 4
ENSDART00000127830 Nonsense 181 308 3 5
ENSDART00000129597 None None 577 None 21
ENSDART00000132077 None None 160 None 8
ENSDART00000134100 None None 248 None 7
ENSDART00000134283 None None 617 None 18
ENSDART00000146378 None None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39493972)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38372775
GRCz11 8 38405714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYGCCCTGAATGTCAAGTGGCCMATTTGGGCAATTMTTGACRTCTATGGA[C/T]AGACCACAAKGGTGACGATGCTTGGTGAGGCTTTTTTGARTTTTCAATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5497
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559 None None 564 None 18
ENSDART00000112991 None None 261 None 4
ENSDART00000127830 None None 308 None 5
ENSDART00000129597 Nonsense 32 577 2 21
ENSDART00000132077 None None 160 None 8
ENSDART00000134100 Nonsense 119 248 3 7
ENSDART00000134283 None None 617 None 18
ENSDART00000146378 None None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39447284)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38326087
GRCz11 8 38359026
KASP Assay ID:
2260-0921.1 (used for ordering genotyping assays)
KASP Sequence:
GCTCACGGATCATTTTCTCAGATGAGGCTCTACCTGGCAGTGGATCGAGA[C/T]AGCACTTCATGACTCCGGATATACCCCAGGATGTAGTAGTCATCTCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15686
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559 Nonsense 326 564 15 18
ENSDART00000112991 None None 261 None 4
ENSDART00000127830 None None 308 None 5
ENSDART00000129597 Nonsense 457 577 17 21
ENSDART00000132077 None None 160 None 8
ENSDART00000134100 None None 248 None 7
ENSDART00000134283 Nonsense 379 617 15 18
ENSDART00000146378 None None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39417688)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38296491
GRCz11 8 38329430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTCTCAGGGTGAGGTGATCTCCATCACCAGGCGTGTTGATGATCATTG[G/A]CTGGAAGGTCGTATTGCTGGCACCACCCGCAGTGGAATCTTCCCTATCAG
Associated Phenotype:
Not determined