Busch Lab

ZMP

si:ch211-248a16.1

Ensembl ID:
ENSDARG00000037415
ZFIN ID:
ZDB-GENE-091116-98
Human Orthologue:
DLGAP1
Human Description:
discs, large (Drosophila) homolog-associated protein 1 [Source:HGNC Symbol;Acc:2905]
Mouse Orthologue:
Dlgap1
Mouse Description:
discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6758 Nonsense Mutation detected in F1 DNA Not yet available
sa32477 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6758
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054452 Nonsense 69 980 1 10
ENSDART00000142971 None None 663 None 9
Genomic Location (Zv9):
Chromosome 24 (position 8962945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9022324
GRCz11 24 9162710
KASP Assay ID:
554-5338.1 (used for ordering genotyping assays)
KASP Sequence:
CGGATCTGGCCAGCAGCACATTTCCACGCAGACATCATGGCTCGCATCAT[G/T]AGCTTAAGGACGAACGTGCCATAGTGCCCTATGTGGGACCAGGGGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32477
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054452 Essential Splice Site 430 980 None 10
ENSDART00000142971 Essential Splice Site 73 663 None 9
Genomic Location (Zv9):
Chromosome 24 (position 8988514)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9047398
GRCz11 24 9187784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATACACCTGTTCACGTTCTTTCTTCTTCTGCTTCTTCCTCTTTTTTTGA[A/G]GGATCAGTGCGGAGTCGCATTCCCCCAAGCTGCAGATTCGGAGTCACAGT
Associated Phenotype:
Not determined