Busch Lab

ZMP

ssrp1a

Ensembl ID:
ENSDARG00000037397
ZFIN ID:
ZDB-GENE-031118-9
Description:
structure specific recognition protein 1a [Source:RefSeq peptide;Acc:NP_997967]
Human Orthologue:
SSRP1
Human Description:
structure specific recognition protein 1 [Source:HGNC Symbol;Acc:11327]
Mouse Orthologue:
Ssrp1
Mouse Description:
structure specific recognition protein 1 Gene [Source:MGI Symbol;Acc:MGI:107912]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31984 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28301
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106155 Nonsense 180 517 5 19
ENSDART00000137795 Nonsense 180 705 5 18
Genomic Location (Zv9):
Chromosome 14 (position 23010635)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCTTTTATGTCCCGCCAAACACTGGAGACGACGGCTCAGACCCTGTG[G/T]AGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106155 Nonsense 412 517 11 19
ENSDART00000137795 Nonsense 412 705 11 18
Genomic Location (Zv9):
Chromosome 14 (position 23003920)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21703408
GRCz11 14 22000653
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCATAATTCAGAAATAATCCTCTCTTCTGCTTTAATAGGGAAGAATA[T/A]GGAAAACTTTTTGACTTTGTCAACGCCAAGAAGCTGACTATCAAGAACAG
Associated Phenotype:
Not determined