Busch Lab

ZMP

st5

Ensembl ID:
ENSDARG00000037363
ZFIN ID:
ZDB-GENE-030131-2547
Description:
suppression of tumorigenicity 5 protein [Source:RefSeq peptide;Acc:NP_001002327]
Human Orthologue:
ST5
Human Description:
suppression of tumorigenicity 5 [Source:HGNC Symbol;Acc:11350]
Mouse Orthologue:
St5
Mouse Description:
suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20954 Nonsense Available for shipment Available now
sa40902 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20954
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054368 Nonsense 127 1129 3 21
ENSDART00000113313 Nonsense 127 1125 3 20
ENSDART00000133050 Nonsense 127 1125 2 19

The following transcripts of ENSDARG00000037363 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29853184)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28245707
GRCz11 7 28516900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAGCCACCAAGTGGTGATAGGCAGGATCAGAAGGAGAATCAGCCACAA[C/T]AGACCCCCCCTATTGGGGATGGATTGAATACTGGACTGCTCAGCTTAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18871
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054368 Nonsense 177 1129 3 21
ENSDART00000113313 Nonsense 177 1125 3 20
ENSDART00000133050 Nonsense 177 1125 2 19
ENSDART00000054368 Nonsense 177 1129 3 21
ENSDART00000113313 Nonsense 177 1125 3 20
ENSDART00000133050 Nonsense 177 1125 2 19

The following transcripts of ENSDARG00000037363 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29853033)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28245556
GRCz11 7 28516749
KASP Assay ID:
2259-8899.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCATACAGGGACGTGCACCTCATCAATCGCCATACGCAAAAAGATCT[C/A]GCAATGGGAGGGTCGGAAGGAGGCTTTGTCTAGGATGAGCCTTTGCCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8269
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054368 Nonsense 177 1129 3 21
ENSDART00000113313 Nonsense 177 1125 3 20
ENSDART00000133050 Nonsense 177 1125 2 19
ENSDART00000054368 Nonsense 177 1129 3 21
ENSDART00000113313 Nonsense 177 1125 3 20
ENSDART00000133050 Nonsense 177 1125 2 19

The following transcripts of ENSDARG00000037363 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29853033)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28245556
GRCz11 7 28516749
KASP Assay ID:
2259-8899.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTCATACAGGGACGTGCACCTCATCAATCGCCATACGCAAAAAGATCT[C/A]GCAATGGGAGGGTCGGAAGGAGGCTTTGTCTAGGATGAGCCTTTGCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054368 Essential Splice Site 1086 1129 None 21
ENSDART00000113313 Essential Splice Site 1086 1125 None 20
ENSDART00000133050 Essential Splice Site 1086 1125 None 19

The following transcripts of ENSDARG00000037363 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29803397)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28195920
GRCz11 7 28467113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGCTGGATTCATCCAGGACCGGGAGATGAGGAAGTGCAGGGCCAAAGG[T/A]AAACCAATAAAAACAAGACCACTTCTCATCAGATGTGATGTCCTGTTAGC
Associated Phenotype:
Not determined